11. Refer to the figure showing a single replication fork. E A D Which statement about the replication fork shown is false? O The replication fork is advancing to the left. O The top template strand is oriented in the 5'-to-3' direction from left to right. O DNA polymerase would be "reading" the top template strand from right to left. O The origin of replication is at the position labeled A.

11. Refer to the figure showing a single replication fork. E A D Which statement about the replication fork shown is false? O The replication fork is advancing to the left. O The top template strand is oriented in the 5'-to-3' direction from left to right. O DNA polymerase would be "reading" the top template strand from right to left. O The origin of replication is at the position labeled A.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

1. Name all the proteins that are in the DNA replication fork in E. Coli, and describe the functions of these proteins. Explain how two DNA strands are replicated at the same time by one replication fork.
6
2. Replicate this strand of DNA:GCA TAG CAA TGC
5. On this replication fork, draw in all of the enzymes and proteins required for DNA replication (DNA Polymerase, helicase, topoisomerase, ligase, primase, and exonuclease). Also draw in and label the primer and new DNA. Indicate which is the leading and lagging strand Label all 5' and 3' ends.
5. Draw the major components of the DNA Pol III replication complex in the context of a replication fork. Be sure to illustrate and label the leading and lagging strands, RNA primers, Okazaki fragments, the polymerase core, the beta-clamp subunits, and the clamp loader complex, and show how the lagging strand is threaded through the replication complex.
2. List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
5. Shorthand DNA is written as antiparallel arrows with 5' and 3' ends. 3' a) What do the 5' and 3' ends signify? b) To which end are new nucleotides added when building a DNA strand?
6
7. Replication factor C plays which of the following roles in eukaryotic DNA replication?A. the sliding clampB. the clamp loaderC. the DNA ligaseD. a single-stranded DNA binding proteinE. a cofactor required for activating the DNA polymerase 8. Phages that program the host cell for continued particle releasing without killing the cell are called ____________ phages.A. lyticB. lysogenicC. temperateD. chronicE. none of the above 9. Retroviruses use _______ to make a DNA copy of their RNA genome.A. restriction enzymesB. DNA polymerase IC. RNA polymerase IID. reverse transferaseE. reverse transcriptase
14
20. DNA polymerase III attaches nucleotides to the 3' end of the newly synthesized DNA strand. True False
1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene product. 3' TAC GAA ATA ACA GTA CGA CCA AAA CTT TAC ACT S 2. Assume the following nucleotide changes in the DNA strand above and write down the amino acid sequences. a. Insert thymine after position 10 of the base. b. Delete base number 9. c. Replace position 18 with guanine. d. Replace the 10th to 12h nucleotides with TAG. e. Replace the 3d to 5th nucleotides with ATT. Guide Questions