11. Refer to the figure showing a single replication fork. E A D Which statement about the replication fork shown is false? O The replication fork is advancing to the left. O The top template strand is oriented in the 5'-to-3' direction from left to right. O DNA polymerase would be "reading" the top template strand from right to left. O The origin of replication is at the position labeled A.

11. Refer to the figure showing a single replication fork. E A D Which statement about the replication fork shown is false? O The replication fork is advancing to the left. O The top template strand is oriented in the 5'-to-3' direction from left to right. O DNA polymerase would be "reading" the top template strand from right to left. O The origin of replication is at the position labeled A.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 12RQ: Which of the following components is not involved during the formation of the replication fork?...

See similar textbooks

Similar questions

Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligase
10. A picture of a replication bubble is shown below. でイトイOpイ TT 3 Primer 5'-CUU-3" is being used to replicate this picce of DNA. What strand this primer will anneal to: the upper or the lower? Write what product of RNA replication would be the first five nucleotides that had been added onto the primer by DNA pol. Mark the 5' and 3' ends. lin
1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATGTCTGGCCTTGAGTAAGGCTAATCACAT GCGTA GCAT Primer BTAATA TCATTC CGATT From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand synthesis?. Top or bottom strand. С. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' Give the sequence of the next four bases that would be added to the growing end of the primer e. 5' 3'
21. During replication one of the parent strands is oriented 3' to 5' direction toward the replication fork and the synthesis of the new strand can continue without interruption as the helicase continues unwinding. The other parent strand runs 5' to 3' direction leaving the synthesis of the new strand to continue in the opposite direction and away from the replication fork. This causes generation of DNA fragments to be attached later. This strand is called lagging strand. True False
5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the other one will go from 5' to 3' direction. During replication or transcription, whatever the process is, it will always follow the 5' to 3' direction using the 3' to 5' directed strand as the template strand. Therefore, if following is the DNA sequence 5'-CCG ATC GCA CAA-3' a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codon II. Absence of start codon III. Due to mutation b) If you want to start the translation, what change you need in the second codon (from 5' to 3' direction)? I. Substitution of C with G II. No change III. Deletion of C IV. Both I & III
6. The following diagram shows a replication bubble within a double stranded DNA molecule. The red arrow shows the direction of the primer. AAAGIACGTIGAC ATTGGCC 3' TAACCGG 5' 5' GTCCGAC 3' CAGGCAG C. 5 CAT&CAACTO a. What is the sequence of the red RNA primer? b. If the replication fork moves to the left (left side opens more), will this primer be used to create the leading strand or lagging strand? Please explain your answer. If you answered the leading strand, explain why replication is continuous. However, if you answered lagging strand explain why replication is discontinuous.
1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication
1. Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can make lines straight and parallel if you would like 2. On the bottom strand starting in middle and pointing to the left, draw a 90 degree arrow to show the start of transcription. 3. Add 10 DNA bases of your choice (A,T, C or G) along the bottom line to left of the 90 degree arrow. 4. Add the complementary DNA bases along the top line. 5. Beginning at the 90 degree arrow, transcribe the DNA into RNA. Write the appropriate letters. Label this as mRNA 6. Label 5' and 3' ends of all nucleic acids. 7. Label the template strand and the coding strands of DNA. 8. Label the promoter. (Upload steps 1-8 but on your own please practice all 4 possible flips of this. Arrow on bottom facing left or right. Arrow on top facing left or right.)
1. Draw a replication fork in the space below. Be sure to label the 5' and 3' ends of the DNA on both strands.