11. Refer to the figure showing a single replication fork. E A D Which statement about the replication fork shown is false? O The replication fork is advancing to the left. O The top template strand is oriented in the 5'-to-3' direction from left to right. O DNA polymerase would be "reading" the top template strand from right to left. O The origin of replication is at the position labeled A.

11. Refer to the figure showing a single replication fork. E A D Which statement about the replication fork shown is false? O The replication fork is advancing to the left. O The top template strand is oriented in the 5'-to-3' direction from left to right. O DNA polymerase would be "reading" the top template strand from right to left. O The origin of replication is at the position labeled A.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The following is a figure that depicts telomerase extending a telomere. -aaucccaauc ttag telomere The lagging strand template for DNA replication of this section of the chromosome is: a. Strand A Ob. Cannot be determined from the information given above O C. Not needed due to telomerase activity O d. Strand B O e. Strand C
22..2 if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the sequence: 3’ UACGCA5’ 3’AUGCGU 5’ 3’ ATGCGT 5’ 3 TACGCA 5’ 3’ ATGCGT 5’
4, Describe the process of DNA replication. In your description, include the terms okazaki fragments, lagging, and leading. polymerase, ligase,
9. Below is a schematic of an origin of 3' replication. a) Would replication in the top strand in region 1 be continuous or discontinuous? Region 1 Region 2 b) Would replication in the top strand in region 2 be continuous or discontinuous?
4. You have a double-stranded linear DNA molecule, the appropriate primers, all the enzymes required for DNA replication, four 32p-labeled nucleoside triphosphates, Mg2+ ion, and the equipment needed to detect newly synthesized radioactive DNA. Why is this system not sufficient to dis- tinguish between conservative and semiconservative replication of the DNA molecule?
6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddTTP were also added. Write out the sequence of 4 DNA fragments you expect to produce in your sequencing reaction. Include the 5' and 3' ends of each fragment in your answer. 3' AAGACTCGATCGATCGTTTCCTCA 5'
E.coli is replicating its chromosome. If the template DNA sequence is: 3' AAA CGC GAT 5', what would be the base sequence of the complementary new DNA strand? O 5'TTT GCG CTA 3' 5' UUU GCG AAU 3' O 3' UUU GCG AAU 5' O 3' TTT GCG AAT 5'
Match to their function from list.
11. please fill in the blanks
33.Choose the DNA nucleotide sequence that would be complementary to the following strand (note: pay attention to DIRECTION of replication): 5' GTAGTCA 3' a 3' UATUAGA 5' b. 5' TGACTAC 3' 3' ACGACTG 5' 5' UGACUAC 3'. 5.Using agarose gel electrophoresis to analyze DNA, short DNA travels the long DNA. a faster than slower than at the same speed as d. Question 6 Which type of bonds link the individual nucleotides together in DNA? Glycosidic bond Peptide bond Phosphodiester bond Electrostatic bond a e Hydrogen bond Question 7 A typical engineered plasmid vector often contains the following features except a A poly linker region Origin of replication A signal peptide An antibiotic resistant gene a. b. C. C. d.
A Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacterium. This bacterium takes 30 min to complete a round of replication at 37° C. Figure 2.1 shows the autoradiography of the replicating DNA molecule. В A C D Figure 2.1 (i) Draw a DNA replication diagram to explain your observation.
6. Below is a double stranded DNA molecule with a replication bubble. The filled lines represent the DNA emplate, the dotted lines represent the primer. Please label all ends of the nucleic acids as either 5' or 3'.