1. State three (3) implications of scientific development on any of the following categories: a. History b. Ethics c. Contemporary society 2. List two (2) reasons why scientific literacy is important. You may relate your answer on decision making, economic productivity and education (considering our present-day situation). Do not forget to cite all your references.
Q: Can I ask for the references? Thanks
A: The question pertains to the concept of genetic mosaicism, which is a phenomenon that occurs when…
Q: 1. In your own words define the process of DNA Replication, Transcription, and Translation.
A: DNA Replication In the process of DNA replication, the DNA makes multiple copies of itself. It is a…
Q: QUESTION 44 If total cross-sectional area of blood vessels in an organ increases, what happens to…
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: Tropical Dry Forest Climate Graph Location: San Juan del Encanto, Bolivia Directions: Analyze the…
A: Whenever we have to study a graph, we should always follow the path of increment or decrement of the…
Q: Which of the following enzymes works best in an acidic environment? a. amylase. b. pepsin. c.…
A: Enzyme activity is estimated in units which demonstrate the pace of reaction catalyzed by that…
Q: 9. Compare and contrast the two major types of neuronal pathways. Give an example of each.
A: The fundamental units of the brain and spinal cord is called neurons. It is also called nerve cells.…
Q: Describe the two functions of the pancreas.
A: Since you have posted questions with sub-parts we solve the first sub-part for you. To get the…
Q: Use the Table here to construct a phylogenetic tree. You can upload a hand drawing and explain your…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 124. List of some plants is given below : Allium, Makoi, Mustard, Petunia, Lupin, Sesbania How many…
A: In Botany the floral formula defines the arrangement and number of calyx,corolla ,gynoecium and…
Q: 14. Name the three main components of the diencephalon, describing their functions.
A: We know that the brain develops from ectoderm and consists of three major parts : Forebrain: It…
Q: Individuals with Marfan Syndrome can have a weakened aorta and be at risk for an aortic aneurysm or…
A: Marfan syndrome is genetic condition in which there is a defect in gene, which produces protein,…
Q: The vegetative body of a myxomyce ed plasmodium The cell wall of fungi consist
A: A diatom is a photosynthetic, single celled organism which means they manufacture their own food in…
Q: Hardy-Weinberg Practice Problems *Remember: p2 + 2pq+q2 = 1 and p + q = 1 *Remember: p2 = AA, 2pq =…
A: According to the Hardy-Weinberg principle, allele frequencies in a population are stable and remain…
Q: Blood doping involves the retrieval and storage of one's own red blood cells over a period of months…
A: Red blood cells are the most common blood cells and the main function of RBC is to transportation of…
Q: The as "rest and digest." Question options: A somatic; visceral B sympathetic; parasympathetic C…
A: The central nervous system and the peripheral nervous system are the two primary components of…
Q: 3) Fill in the Venn Diagram comparing and contrasting Sexual and Asexual Reproduction. Have at least…
A: Reproduction is the process by which parents create new people or children. This procedure assures…
Q: Use the information in the figure, below. Include units in your answer. Round numbers to 3 decimal…
A: BSA standard curve: Bovine Serum Albumin(BSA) is a Globular protein that is being used as a standard…
Q: QUESTION Indigestion Do you experience indigestion? Character: Describe how this feels. Onset: When…
A: Indigestion is defined as pain in the stomach caused by difficulty in dealing with food. Sometimes…
Q: 2. Describe the structure of neurons and the function of their components. Describe the location,…
A: The functional unit of nervous system is called neurons. The size varies from 4 to 100 microns. The…
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…
Q: TCA cycle
A: TCA cycle is known as Tricarboxylic acid cycle. it is also known as Kreb's cycle. This pathway is…
Q: 2. Transcription of gene X is controlled by transcription factor A (TFA). Gene X is only transcribed…
A: Transcription factors are the proteins involved in the process of transcription. Transcription…
Q: 5. List the series of events at the membrane that generate an action potential, including the…
A: Neurons The special type of cell which carry signal from stimulus to brain and vice versa.
Q: 108. Find out the mismatch with respect to fungi :- (1) Aquatic habitat-phycomycetes (2) 8 asexual…
A: Kingdom fungi consist of heterotrophic organisms. They can be saprotrophic and parasitic. The cell…
Q: The Role of Top-Down Modulation in Shaping Sensory Processing Across Brain States: Implications for…
A: Introduction Top down-modulation is a psychological way of processing and drawing information from…
Q: Describe what manifold design is and explain why our circulatory system is structured that way. You…
A: Closed circulatory system is a type of circulatory system in which blood flows inside the blood…
Q: 1 A microorganism that can survive pickling and refrigeration was discovered when a tightly-sealed…
A: As you have posted 4 questions I will answer three questions. For last question you have to post it…
Q: A. The two rabbits with these corresponding genotypes were mated; CCch X CCh . Do the cross and…
A: In rabbits, the coat colour is determined by multiple alleles. These alleles are C for agouti or…
Q: Please find the attached file.
A: Ames test is used to test for a mutation causing the ability of a chemical in the DNA…
Q: Which of the following structures in a flower is not directly involved in reproduction? Select the…
A: According to the question, we have to mention the structure given in the option is not directly…
Q: 2- 3
A: Amphibians are unique in their ability to live both on the land and in water and metamorphosis…
Q: 4. Explain the resting membrane potential and the roles of the K+ leak channels and the…
A: Introduction :- The voltage across a certain cell membrane at rest is known as the resting membrane…
Q: The R&D project teams of a pharmaceutical company: Select one: O a. Are usually led by the marketing…
A: Pharmaceutical R&D refers to the pharmaceutical research and development of new medicine. The…
Q: Name this tissue Draw arrows to the tissue parts above. Where is the basal surface? ● ● ● Where is…
A: Note:- Please note that the resolution of image 2 in the integumentary system is not enough clear…
Q: Questions 11-13 are all based on the following information: Human chromosome 4 is about 215 CM long.…
A: The gene that codes for a specific trait, have two alternative forms called alleles. The genotype of…
Q: Patient C's Karyotype 1 2 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 3.
A: A karyotype is an individual's collection of chromosomes. Karyotyping is a test to examine…
Q: Primary Succession Greatest Biodiversity Little Biodiversity Climax Community What is happening to…
A: Primary succession is a very slow process and begins where no ecosystem existed before. It starts on…
Please see attached file. Thank you
Step by step
Solved in 2 steps