1 2 3 4 M 1000 b 900 bp 800 bp 700 bp 600 bp 500 bp 400 bp 300 bp 200 bp

Q: For each individual on gel, determine if the individual is homozygous for presence of the Alu…

A: In gel electrophoresis the fragments which are Small os size ( less base pairs) travel further in…

Q: Ethidium bromide used to be a common stain for detecting DNA/ RNA on agarose gel. (i) Describe how…

A: Ethidium Bromide is a DNA stain as well as a mutagen. This dye can be visualized under UV light. It…

Q: expanded structure of the D-tagatose Fischer projection of D-tagatose Haworth projection of…

A: The objective of the question is to understand the different structural representations of…

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: Which molecule in the gel is the smallest - A, B, C, or D? Explain how you determined this. B)…

A:

Q: 2. How are enzymes involved in this process? 3. What happens when DNA "unzips"? 4. Why is it…

A: This page contain link but that link is not opening so we are answering first 3 questions. For rest…

Q: Why is R-banding significant when its banding pattern is just the reverse pattern of G-banding?

A: Banding technique: the given banding technique is of chromosome banding techniques i.e. G-banding,…

Q: In standard agarose gels used for the analysis of DNA, linear DNA fragments are separated on the…

A: Agarose gel electrophoresis is the most effective, easy, and efficient way to purify, separate,…

Q: What do you mean by spore tetrade?

A: Ans: The arrangement of cells in group of four by successive division of the parent cells forms the…

Q: How much of a 10 mg/mL lysozyme stock would you need to add to 4 mL of cells for a final…

A: The concentration (C1) of stock solution is: 10 mg/ml The concentration (C2) of working solution is:…

Q: Both protein and DNA are run together in an isoelectric focusing (IEF) electrophoresis using the…

A: Isoelectric focusing electrophoresis is a technique which is used for separation of amphoteric…

Q: Draw the following trinucleotide: pGAU

A: A nucleotide is composed of a nitrogen base, a pentose sugar and a phosphate group. A trinucleotide…

Q: What are Okazaki fragments? Why are they formed?

A: All life is dependent on DNA. It contributes to the genetic code for life and its activities,…

Q: Which forward are reverse primers will amplify the following sequence by PCR?…

A: As given in the question, forward and reverse primer sequences are to be identified to amplify the…

Q: A nonapeptide was treated with dithiothreitol to reduce any disulfide bridges, then partially…

A: Amino acids are the basic unit of the peptide and proteins. They are joined via the peptide bonds to…

Q: Give an example of the beta-pleated sheet?

A: BASIC INFORMATION  BETA - PLEATED SHEETS It is formed during the formation of proteins. It is…

Q: How is a DNA viewed on an agarose gel?

A: DNA stands for deoxyribonucleic acid. On an agarose gel, DNA is stained with the ethidium bromide.…

Q: are all the protein separated properly using isoelectric focusing? why or why not?

A: The proteins are composed of amino acids that have ionizable side chains with characteristic pKa…

Q: Given a primer sequence 3’- CTGGGAAACATTCTGGAT - 5’, compute for the melting temperature of this…

A: Melting temperature of primer can be defined as a temperature at which one half of the DNA double…

Q: What do you mean by Roflumilast ?

A: The activity of the enzyme can be inhibited wither reversibly or irreversibly. Irreversible…

Q: What is 7-methylguanosine (m7G) cap ?

A: The mRNA cap is a profoundly methylated alteration of the 5′ finish of RNA pol II-translated RNA. It…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: Can someone give me examples of denatured proteins that can be brought back to native state…

A: The question asks the examples of denatured protein which can be transformed into the renatured or…

Q: You are trying to isolate a protein you don't know much about, so you decide to use a gel column…

A: Introduction :-  Chromatography is a biophysical technique which is used to separate or isolate the…

Q: In serine protease mechanism, which specie(s) act(s) as a nucleophile? A.) serine B.) histidine C.)…

A: A protease is an enzyme that catalyses the breakdown of proteins into smaller polypeptides or…

Q: What is the beta-pleated sheet?

A: When two or more polypeptide chain segments line up side by side, beta-pleated sheets form. A…

Q: Which well(A through E) of this agarose gel contains the smallest DNA size? Please look at the pic.

A: Gel electrophoresis technique of separation of molecules on the basis of their size and charged…

Q: What additive in the agarose gel solution allows the DNA to fluoresce (glow) under UV light? How…

A: Electrophoresis is the migration of charged particles under the influence of an electric current.…

Q: c) Let us consider the following toehold DNA system: 2 2* 1/2 12 In textual form this is given by…

A: In the provided scenario, question (c) examines the impact of extending the toehold length from 4 to…

Q: Strain W Strain X Strain Y Strain V Strain Z Under these conditions, rank cterial strains from most…

A: In competitive dominance hierarchy diagrams, the arrow suggests that the pointed species is more…

Q: Modify methionine to show its zwitterion form.

A: Here an amino acid "Methionine" is given which has following structure:-

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: explain the differences between the Gram-negative and Gram-positive bacteria cell wall structure and…

A: Gram staining: It is a widely employed method to identify and differentiate two large groups of…

Q: Agarose gel clectrophoresis is a technique used to separate DNA fragments on an agarose matrix. The…

A: In biotechnology the separation of samples like DNA, RNA and proteins are performed by gel…

Q: 1) The Nde1 enzyme comes at a concentration of 40 U/ul. According to the manufacturer, the container…

A: Question 1: Enzyme ConcentrationThe Nde 1 enzyme comes with a specified concentration of 40 U/μl.…

Q: Task 2: Find where the primers bind to in the gene sequences on Moodle (kan has been provided for…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: Each of the following pairs of primers has a problem with it. Tell why the primers would not work…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: CH, H H ОГТІ 0= II Т Н H-C- H₂C-N-C-C-O-P-OC-H CH, H H О 1 H-C-0 -Т Н 2 онннн Н II ТТГ Н Н Н Н Н Н Н…

A: A molecule is the smallest part of any substance that is made up of different atoms connected…

Q: Second letter C UUU Phe UCU) UCC UGU UAU1 Tyr UAC S U UUC U UUA L UUG J Ser UGCCYS UAA Stop UGA Stop…

A: tRNA is an amino acid acceptor which carries the amino acid corresponding to the code present in the…

Q: 5- Which statement is not true for agarose gel electrophoresis? a) DNA fragments are separated based…

A: The technique which is used for the separation of DNA fragments is called agarose gel…

Nutrient Growth Medium

It is a culture medium or nutrient broth for all kinds of microorganisms to grow properly and create their colony. This matrix provides support to increase the population of microbes through the method of cell proliferation. It is regarded as the food material for those organisms. It is a type of in vitro mechanism, in which the development of life is processed outside the host body. It can be solid, semi-solid, or liquid in nature. Different kinds of cells develop in different types of media.