Footprint

docx

School

Central Washington University *

*We aren’t endorsed by this school

Course

285

Subject

Geography

Date

Oct 30, 2023

Type

docx

Pages

2

Uploaded by ElderIron5242

Report
Footprint for: Scenario 1 Your Normal Consumption Scenario 2 Your Decreased Consumption Number of Planets Needed 4.1 Earths 3.2 Total Footprint (hectares) 6.7 5.2 Carbon (tons) 13.3 10.1 Carbon (% of total Footprint) 68 66 Food (hectares) 1.4 1.2 Housing (hectares) 0.3 0.4 Goods (hectares) 1.6 0.9 Services (hectares) 0.8 0.7 Mobility (hectares) 1.6 2.1 I got these data from the Footprint calculator. At first, it was a little abstract, I then went in to add more details. The components once broken down are easier to estimate, for instance, if meat, dairy, or fish was consumed daily or occasionally. After all the questions were answered, the site calculated and generated a report with all the data above. This quantitative data results from how my life decisions can affect the environment. It gave me my total footprint and then broke it down to show which area of my life carries the most impact. It’s generally hard for people to imagine the results of their life decisions if it doesn’t carry an immediate impact. When people think about carpooling, the immediate impact is they can save
on gas and mileage on their car, they can also take the carpool lane and reduce emissions. In this case, reducing emissions is something they cannot see or feel the result instantly, but rather it’s a joint effort and the effect carries over time. The footprint calculator helps to show the result vividly and provides a way to estimate the impact. It helps raise awareness and educate people on the impact humans have on the environment. It’s an ongoing effort in order to sustain our Earth.
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help

Related Documents

Discussion 2.docx
- Earth's Heating Sources Article 2022.pdf
Wicked Problems.docx
Global Circ Patterns.pdf
Activity 2_ Patterns and Trends.pdf
EXTRA CREDIT FOR TEST 1.docx
IMMIGRANTS IN CANADA ..docx
The Dynamics of Geopolitics.pdf
bio paper.docx
Japanese Readings Notes.pdf
Transcript-1 (5).pdf
Transcript-1 (38).pdf

Browse Popular Homework Q&A

Q: Think of a real-life example of cognitive dissonance reduction as described in Glass’s experiment…
Q: How to prevent any health problems that social media may cause. Supply the table by this information…
Q: Question 33 ACME Incorporated had the following balances for its equity accounts on the company's…
Q: A structural member with a rectangular cross section as shown in the accompanying figure is used to…
Q: what are diversity related challenges that BMW can have?
Q: Explain how familial retinoblastoma is inherited at the: a. Čellular level Vs. b. The pedigree level…
Q: 5 current issues in the Philippines. with reference (aricle) PROBLEM CAUSES EFFECTS SOLUTIONS…
Q: Max, a single taxpayer, has a $270,000 loss from his sole proprietorship in 2021. How much of this…
Q: The total number of trips from ABC to XYC is 4500. All of the trips are made using car. The…
Q: Coupons and rebates benefit different distribution channel members. Which would you prefer if you…
Q: Draw the polymer structure of spun viscose
Q: From the figure shown which of the following gives the best outside diameter in increments of 2mm. D…
Q: Knowing that: in linear polymers the individual polymer chains rarely have the exact same degree of…
Q: Problem 3 (Vitali's covering theorem). Let F be any collection of nondegenerate closed balls in R"…
Q: Show how the 1920s represented a clash of culture between rural and urban America.
Q: The Elgin marbles. Why are they so controversial? What are the issues surrounding them? In your…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
Q: Draw the two possible produ that result from the less stable enolate and the more stable…
Q: ow is a factored into this?
Q: 1. On the back of Elise's monthly statement, she listed the following outstanding withdrawal #123,…
Q: What advise would you give to your parents or grandparents to help them age gracefully and ease into…
Q: 4. How will your professional Code of Ethics help to guide you in making ethical decisions and…
Q: 12. The 180-day interest rates in Canada and U.K. are 7% and 3%, respectively. The spot exchange…
Q: Can you think of one organism not mentioned in thischapter as a keystone species that you believe…
Q: 1. 4. 7. 10. X X X X 4.3 .8 35.44 20.3 1.6 14.21 13.5 .50 ,675 6.92 .43 Multiplying Decimals 2. 5.…