Copy of INFO 4 Transcription and translation application problem and KEY

docx

School

University of Notre Dame *

*We aren’t endorsed by this school

Course

197

Subject

Biology

Date

Apr 3, 2024

Type

docx

Pages

2

Uploaded by DeanStarOwl18

Report
Transcription and translation application problem Use the space below to transcribe and translate a gene starting with the DNA. TRANSCRIPTION: 1. Below is a DNA sequence of a simple gene. 2. Show attachment and direction of synthesis of RNA polymerase enzyme. 3. Label the template and non-template strand of the DNA . 4. Write out the sequence of the mRNA transcribed from this gene and label 5’ and 3’ ends. _________promoter __________ ↓ transcription start 5’ TCGAGCG TATAAA GTGGCAA|AGTATTTAAAGGTAACCCGATGCCTTGGCAGTTAAGGTCAATTTGACCAT 3’ 3’ AGCTCGC ATATTT CACCGTT|TCATAAATTTCCATTGGGCTACGGAACCGTCAATTCCAGTTAAACTGGTA 5’ ANNOTATE YOUR mRNA TRANSCRIPT : 5. Scan the mRNA for a start codon (AUG) and highlight. (HINT: don’t break into triplets, just look for an AUG) 6. Break sequence into triplets beginning with AUG. 7. Find the stop codon (UAG, UAA, UGA) and highlight. 8. Underline and label the 5’ untranslated region before the start codon. 9. Underline and label the 3’ untranslated region after the stop codon. 10. Draw a box around the coding region of the mRNA sequence. TRANSLATION: 11. How many amino acids will be in the translated protein? 12. Use the codon table to generate the sequence of amino acids that make up the protein. Transcription and translation challenge problem
Use the space below to transcribe and translate a gene starting with the DNA. TRANSCRIPTION: 1. Below is a DNA sequence of a simple gene. (no introns) 2. Show attachment and direction of synthesis of RNA polymerase enzyme. 3. Label the template and non-template strand of the DNA . 4. Write out the sequence of the mRNA transcribed from this gene and label 5’ and 3’ ends. RNA POLYMERASE ------> _________promoter ______↓transcription start 5’ TCGAGCG TATAAA GTGGCAA|AGTATTTAAAGGTAACCCGATGCCTTGGCAGTTAAGGTCAATTTGACCAT 3’ non-template 3’ AGCTCGC ATATTT CACCGTT|TCATAAATTTCCATTGGGCTACGGAACCGTCAATTCCAGTTAAACTGGTA 5’ template 5’ AGUAUUUAAAGGUAACCCG AUGCCUUGGCAGUUAAGGUCAAUU UGA CCAU 3’ RNA transcript Untranslated region coding region (ORF) untranslated region ANNOTATE YOUR mRNA TRANSCRIPT : 5. Scan the mRNA for a start codon (AUG) and highlight. (HINT: don’t break into triplets, just look for an AUG) 6. Break sequence into triplets beginning with AUG. 7. Find the stop codon (UAG, UAA, UGA) and highlight. 8. Underline and label the 5’ untranslated region before the start codon. 9. Underline and label the 3’ untranslated region after the stop codon. 10. Draw a box around the coding region of the mRNA sequence. (in bold) TRANSLATION: 11. How many amino acids will be in the protein? 12. Use the codon table to generate the sequence of amino acids in protein. AUG| CCU|UGG|CAG|UUA|AGG|UCA|AUU| UGA 8 amino acids Met—Pro---Trp—Gln--Leu—Arg—Ser--Ile
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help