Danielle Clements- Tree Thinking - Tagged

pdf

School

University of Maryland, Baltimore County *

*We aren’t endorsed by this school

Course

142

Subject

Biology

Date

Dec 6, 2023

Type

pdf

Pages

Uploaded by SuperIceHare42

Tree Thinking In the age of genomics, groups of organisms can be compared by their DNA and evolutionary relationships can be inferred based on information in these sequences. There are many different algorithms in bioinformatics used to build molecular phylogenies, but today you will learn about simple genetic distance. Assignment prior to active learning: draw a phylogenetic tree showing relationships between old world monkeys, new world monkeys, chimpanzees, gorillas and humans and bring this to active learning. Use your notes from the human evolution lecture to determine relationships. Questions in blue are recommended to be completed/attempted on notebook paper BEFORE you meet in active learning. Use your textbook/internet to define the following in your own words: 1. Phylogeny: 2. Cladogram: 3. Chronogram: PART I: USING A MOLECULAR CLOCK A molecular clock uses changes in DNA sequences to infer the time since two species diverged. To set, or calibrate, a molecular clock, we need to calculate how much DNA sequences from a common but neutral genomic region have diverged over a known period of time. Below are sequences from an imaginary gene for three closely related organisms. Most genes consist of several thousand nucleotides, but for demonstration purposes, we are only going to use some of the bases. Calculate the percentage sequence divergence between all three sequences. First examine the sequences in question and count the differences between them. Divide the difference by the total number of nucleotides (80), and then multiply by 100 to convert to a percent. DNA Sequence of Cyt-b (Mitochondrial DNA) Human ACTAGCAACGGATACCATAGGTATATCTAGGCTACATTGTTAGCTTACCGCTAGTACTGGTGACTCTAGAATGCCTAGTC Chimp ACTAGAAACGGTTACCACAGGTATATCAAGGCAACATTGTTACCTTACCGCTAGTACTGGTGACTCTCGAATGCCTTGTC Baboon ACTGGATGCGGATGCCTCAGATTTATCAAGGCTACAATGTTACCATAGCGATACTTGTGGTGACTGTCGATTGCCTAGTG

4. Human and Chimp: 5. Chimp and Baboon: 6. Baboon and Human: The major assumption of a molecular clock is that sequence divergence increases over time in a linear manner as species diverge. This means that species that diverged 4 million years ago should have twice the sequence divergence as species that diverged 2 million years ago. If one knows when two species diverged (by using the dates of fossils, geological events, etc.), one can use this information to calibrate a molecular clock for that particular region of the genome. That clock can then be applied to other species and used to determine when other species diverged. Use the equation D=μt where D=% sequence divergence, μ=mutation rate, and t=time since divergence (in millions of years) for the next 4 questions. Example: If your time since divergence is 8 million years, t = 8. 7. First calculate the mutation rate for each species pair below. What is the average mutation rate, μ (% divergence per million years), for this particular gene? Include units! Species-Pair Sequence Divergence Time Since Divergence (yrs) μ Human-Chimp 9.8% 5.5 million Human-Gorilla 12.0% 7.0 million Chimp-Gorilla 12.8% 7.0 million Average μ = 8. If the sequence divergence between chimpanzees and bonobos at this gene is 4.2%, calculate the estimated time since divergence between chimps and bonobos using the average μ from above. Show your work and include units!

9. A strict perfect molecular clock predicts that the human-gorilla percent sequence divergence should be exactly the same as the chimp-gorilla percent sequence divergence. [Think about why that should be; drawing a tree of the three species should help.] However, there is a difference in the above table. Propose a potential explanation for why the % sequence divergence differs between human-gorilla and chimp- gorilla even though time since divergence is the same. 10. APPLYING WHAT YOU KNOW: The sequence divergence between modern H. sapiens and Neanderthals (based on DNA obtained from fossils) is 1.2% at this gene. Using the average u you calculated earlier, how long ago did modern H. sapien and Neanderthal share a common ancestor? Include units! 11. Construct an UNSCALED TREE (cladogram) showing the relationship between humans, chimps, bonobos, and gorillas using this sequence data (draw an arrow to indicate the TIME axis). Note: Please draw a bracketed tree, not a triangle/wedge tree. You may draw it and upload a picture, or you can use the insert shapes or insert drawing tools on word/google docs.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

12. Now construct a SCALED TREE (chronogram) showing the relationship between humans, chimps, bonobos, and gorillas using this sequence data. How is it different from your cladogram? Note: Please draw a bracketed tree, not a triangle/wedge tree. Please remember a timescale should NEVER vary in the units between ticks. Each tick should be evenly spaced and represent the same amount of time passing. 13. Do you think the common ancestor to humans, chimps, bonobos and gorillas walked full-time upright on two feet (biped)? Use parsimony to explain. PART II. BASED ON PROTEIN SEQUENCE DATA The amino acid sequence for cyt-c gene differences for some species are given below. ● Humans and rhesus monkeys: 1 ● Between humans and chickens/turkeys: 7 ● Between humans and ducks: 6 ● Between humans and Neurospora: 29 ● Between rhesus monkeys and ducks: 5 ● Between rhesus monkeys and Neurospora : 28 PARSIMONY: the most likely explanation implies the least amount of change; the simplest explanation is preferred.

● Between rhesus monkeys and Chickens/turkeys: 6 ● Between ducks and chickens/turkeys: 1 ● Between Neurospora and baker’s yeast: 26 ● Between chickens and turkeys: 0 14. Draw a CLADOGRAM showing how humans, rhesus monkeys, ducks, chickens/turkeys, and Neurospora are related to each other. 15. Explain how the chicken-turkey relationship is possible given that they are classified as different species.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

Related Documents

advanced neurobio exam 1.docx

case studsy 2.docx

BADDDD BLOOODD.doc

adv neurobio exam 2 .docx

Bio 182 Lab report.docx

Lesson Plan (1).docx

MEGA Tetrapods-Danielle Clements - Tagged.pdf

Danielle Clements- Ecological Modeling.pdf

Dichotomous Key Cells & Viruses- Post Lab questions and photos.docx

EVR1001L_Fall_2023_Lab_4_(1).docx

Lab 13. DNA Biology and Technology.docx

BIOL 1108L Field Survey Make Up Assignment 2.docx

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co...

Biology

ISBN:9781305251052

Author:Michael Cummings

Publisher:Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Cengage Learning

Human Biology (MindTap Course List)

Biology

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cengage Learning

Concepts of Biology

Biology

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...

Biology

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cengage Learning

SEE MORE TEXTBOOKS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning