Final_study_guide_3400_

pdf

School

Los Angeles City College *

*We aren’t endorsed by this school

Course

3400

Subject

Biology

Date

Oct 30, 2023

Type

pdf

Pages

15

Uploaded by Shelly1999marie

Report
I. Chromosome Structure and Organelle DNA a. DNA Structure i. double Helix ii. phosphate deoxyribose backbone iii. base pairs Adenine, thymine, and Guanine, Cytosine (pair through hydrogen bonding) iv. G to C have 3 H bonds, and A to T/U have 2 H bonds b. Parts of a Nucleotide c. Comparing DNA & RNA 1. DNA encodes all genetic info, Storage device, Two stranded double helix. Base pairs A-T and G-C, made of deoxyribose, eukaryotic cells have DNA in their nucleus. i. The phosphate group bonded to a sugar with phosphodi ester bonds , then the sugar bon ded to a nitrogenous bas e wit h glyco sidic bonds , and then nitrogenous bases bond complimentary to each other with Hydrogen bonds
2. RNA functions as a reader that decodes the genetic info; there are mRNA, tRNA builds proteins, and rRNA process proteins and export them from the cell. RNA has a ribose sugar. The base pairs are A-U and G-C. II. DNA REPLICATION AND RECOMBINATION a. Where? i. DNA replication in eukaryotic cells occurs in the nucleus ii. DNA replication in Prokaryotic cells is in the cytoplasm b. When? i. DNA replication happens before the cell divides so the new daughter cell can get a copy of DNA. Happens in the interphase (s phase) before Mitosis or Meiosis c. Enzymes in DNA replication 1. DNA helicase – unwinds and separates double-stranded DNA as it moves along the DNA. It forms the replication fork by breaking hydrogen bonds between nucleotide pairs in DNA. 2. DNA primase – a type of RNA polymerase that generates RNA primers. Primers are short RNA molecules that act as templates for the starting point of DNA replication. 3. DNA polymerases – synthesize new DNA molecules by adding nucleotides to leading and lagging DNA strands. 4. Topoisomerase or DNA Gyrase – unwinds and rewinds DNA strands to prevent the DNA from becoming tangled or supercoiled. 5. Exonucleases – a group of enzymes that remove nucleotide bases from the end of a DNA chain. 6. DNA ligase – joins DNA fragments together by forming phosphodiester bonds between nucleotides. d. Replication Process 1. Replication Fork formation 2. 5’ to 3’ leading strand 3. 3’ to 5’ lagging strand 4. DNA Polymerase works only in 5’ to 3’ (Elongation) 5. Primase starts the process by making a small piece of RNA called the primer. 6. DNA polymerase binds to the primer and makes the new strand 7. A lagging strand with DNA polymerase makes small chunks called Okazaki fragments 8. Exonuclease removes all the RNA primers from both strands of DNA (Termination) 9. DNA Polymerase fills in the Gaps 10. Ligase seals fragments of each strand
11. DNA replication is Semi conservative = each DNA molecule is made up of one old conserved strand of DNA and one new one - Replication occurs at A and T-rich sites because of only double H+ bonds, which take less energy to break. e. Differences between Eukaryotic and Prokaryotic cells Eukaryotes Prokaryotes Linear chromosome Circular Genome DNA repl. Is in the Nucleus DNA repl. In the cytoplasm Multiple origins of replication Single origin of replication Also specific but diff Initiation point specific at the ori DNA polymerase 5 types alpha,beta … DNA Polymerase 1,2,3 f. Similarities in Replication between Eukaryotic and Prokaryotic cells i. DNA Ligase and Primase g. Initiation, Elongation, and termination in eukaryotes and prokaryotes i. Initiation to elongation 1. Synthesis of RNA primer a. Eukaryotes & prokaryotes: primase synthesizes RNA primer. 2. Synthesis of new DNA strands a. Eukaryotes: i. DNA POLY APLPHA α : Starts synthesis of new DNA on both leading and lagging strand
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
ii. DNA POLY DELTA ࠵? : complete synthesis of Okazaki frag iii. DNA POLY EPSILON ࠵? : completes the synthesis of the leading strand b. Prokaryotes: i. DNA polymerase III: synthesizes new DNA on both leading and lagging strand ii. Elongation 1. Excision of RNA Primer : a. Eukaryotes: i. Endonuclease removes RNA primer ii. DNA Poly alpha replaces ribonucleotides with deoxynucleotides b. Prokaryotes i. DNA polymerase I removes the RNA primer from 5’ to 3’ exonuclease and replaces it with the 5’ to 3’ deoxynucleotides 5’ to 3’ polymerase 2. Sealing Okazaki fragments a. Eukaryotes & prokaryotes: i. DNA Ligase seals the Okazaki fragments iii. Termination: 1. Proofreading of the new DNA strands: a. Eukaryotes i. DNA Poly Delta and Epsilon proofread the new strands with 3’ to 5’ exonuclease ii. DNA poly alpha- replaces with correct nucleotide b. Prokaryotes: i. DNA poly I and III proofread new strands with with 3’-5’ exonuclease and corrects the mistake with 5’- 3’ poly 2. Termination of DNA replication: a. Eukaryotes: i. Replication is terminated when two replication forks collide with each other b. Prokaryotes: i. Replication is terminated by TUS protein after binding to Ter region of termination.
III. DNA TRANSCRIPTION a. DNA Transcription: Making mRNA i. Replication: makes DNA from DNA ii. Transcription: makes mRNA form DNA iii. Translation: makes proteins from mRNA b. 3 Stages i. Initiation: the beginning of transcription occurs when RNA polymerase binds to the promoter signaling DNA to unwind and becoming ready to make mRNA with a complimentary strand. ii. Elongation: added nucleotides to the mRNA strand. So A-U binding iii. Termination: end of transcription occurs when RNA poly crosses a stop sequence. The mRNA strand is complete and detaches from the DNA
IV. Post-transcriptional mRNA processing and Translation a. EUKARYOTIC Pre-mRNA processing i. The three most important steps of pre-mRNA processing are the addition of stabilizing and signaling factors at the 5ʹ and 3ʹ ends of the molecule, and the removal of intervening sequences that do not specify the appropriate amino acids. ii. 5’ cap (7-methylguanosine) protects the 5’ end from nucleases iii. 3’ poly A tail protects mRNA from degredation and helps to export mature mRNA into the cytoplasm
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
b. Intron Processing The process of removing introns and reconnecting exons is called splicing. ● Introns are removed and degraded while the pre-mRNA is still in the nucleus. ● Splicing occurs by a sequence-specific mechanism that ensures introns will be removed and exons rejoined with the accuracy and precision of a single nucleotide. ● The splicing of pre-mRNAs is conducted by spliceosomes c. Translation Elongation
d. Large subunit V. Control of Gene Expression a. Repressors i. Operator= region where DNA is downstream of RNA polymerase binding site (promoter) ii. The repressor binds to the operator, preventing RNA polymerase from binding to the promoter, and stops transcribing the operon. iii. When the repressor is bound to the operator, no transcription occurs, and no mRNA is made.
b. Activators i. Activator protein binds to a specific DNA sequence helping polymerase to attach to the promoter and transcribe the genes of the operon leading to high production of mRNA c. Lac operon i. Without lactose, the lac operon binds to the operator getting in the way of RNA polymerase and not allowing transcription. ii. With allolactose, it binds to the repressor allowing the repressor to release from the operator allowing RNA polymerase to move forward and transcribe.
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
d. TRP operon i. Low Tryptophan: the trp repressor is not bound to the DNA operator it allows RNA polymerase to bind to the promoter and transcribe the operon ii. High Tryptophan: the tryptophan is bound to the trp repressor causing the repressor to become active and bind to the operator blocking RNA polymerase from starting transcription
e. Transcription factors
FINAL STUDY GUIDE I: DNA Replication & The Genetic Code 1. PCR (polymerase chain reaction) is a process by which scientists recreate the Conditions of DNA Replication in a test tube. We use Taq (thermostable) polymerase, but we want to know - can you guess the other i ngredients in the reaction mixture? HINT: Reaction is carried out in an enzyme buffer solution. 2. Note the strand sense of DNA. Transcribe and translate the DNA codes to a peptide: a. 3’- TACCGGAGGTTGACT-5’
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
b. 3’-TACGGTAATTCGATGACT-5’ c. 5’-ATGCCAATCCGGTCA-3’ d. 5’-ATGCCGGTCTCCTCA-3’ FINAL STUDY GUIDE II: DNA Transcription & Translation 1. Draw a diagram representing prokaryotic transcription and translation. Try eukaryotic on the back of this sheet!: 2. Label the diagram of The Central Dogma of Molecular Biology below:
3. Find the start codon AUG and translate the polypeptide, label the introns and exons: CACUUGCAUCCACGGACUAUGCCGAUUCGUUAAUGAAGCUACUAGCAUGCUAGCAUCGA DNA REPLICATION PRACTICE: COMPLETE THE TABLE WITH THE CORRECT WORD
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help

Related Documents

Review Activity 7 Concept Map.pdf
Lab_4_Roots_Stems_Leaves_2.pdf
Ch+3+Part+1+Lecture+Questions_2.pdf
Ch.+3_2+Lecture+Questions_2.pdf
AP_5069_L13_Respiratory.docx
Reproductive Multiple Choice Questions HAN 202(1).docx
Library Lab.docx
AliKhelil_101258560_A14_tutorial1.pdf
Annotated Bibliography.docx
Conference paper outline.docx
Lab 0 Assignment Ali Khelil 101258560 (3).pdf
Lab 1 Assignment .docx
Recommended textbooks for you
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
SEE MORE TEXTBOOKS
Recommended textbooks for you
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
SEE MORE TEXTBOOKS

Browse Popular Homework Q&A

Q: A non-zero alpha can be an arbitrage opportunity. O True O False
Q: Bubble Sorting an Array of Objects Create a Student class and you will need to do the following:…
Q: 10 KNO3 (s) + 8 C (s) +3 S (s) → 2 K2CO3 (s) + 3 K2SO4 (s) + 6 CO2 (g) + 5 N2 (g) If 75.35 grams of…
Q: in java  Write a program to calculate item’s sale price 1)Ask user to enter the name of item e.g…
Q: Assume that adults have IQ scores that are normally distributed with a mean of 100.3 and a standard…
Q: Shown below is the PV-diagram for a clockwise cycle. Determine the work done during the cycle, the…
Q: Let w(x, y, z) = x² + y² + z² where x = Calculate dx dt dy dt dz dt = dw dt || by first finding…
Q: If the inputted integer value is a java program called RockPaperScissors With the following sample…
Q: Find √(526 5x + 3x7) dx + C
Q: Solve the following trigonometric equation on the interval [0, 2π). Choose all correct answers.…
Q: Write the sum using sigma notation: 6+8+10 + 12 + A = Β: = A + 32 = Σ B, where n=1
Q: Solve the following using the graph: NegativeExternalities.pdf 4) Calculate the cost borne to…
Q: Find the product of the sum and difference of two terms. (7x²+2)(7x²-2) (7x² + 2)(7x² − 2) =…
Q: the muzzle velocity of a new cannon. It was 289 m/s. Now the cannon is deployed and the military…
Q: 7. Your company is considering the introduction of a new product line. The initial investment…
Q: I only need the answers
Q: To produce one more yard of X , you need 1/MPLCx hours of labor. true or false
Q: An engine absorbed 865,500 3 of energy from a reservoir that had a temperature of 539 K and expelled…
Q: A sequence is given by the recursive definition bn = 4bn−1, b0 = 3. a) Find b1, b2, b3 b) Find a…
Q: Evaluate the following integral over the Region R. (Answer accurate to 2 decimal places). 1 / 130 R…
Q: Problem 4. For S = {0, 1,2}, T = {A, B, C}, Give the image of each of the following functions f: ST,…
Q: If Cov(X,Y) = 270, then what is Cov(16X, 3Y)?    If Cov(X,Y) = 13, then what is Cov(.50X, 100Y)?…
Q: January Any Chua February Scott Sampson Speake Fossil The February Scott Samp What's 75 mil spanking…
Q: Which has more hydrogen ions, grapefruit juice (pH = 3) or tomato juice (pH = 4) and how much more…
Q: is steric hinderance not an issue here? why when reacting with KOC(CH3)3 does it yield…