Tutorial #4 Worksheet

docx

School

Castlebrooke Secondary School *

*We aren’t endorsed by this school

Course

123

Subject

Biology

Date

Nov 24, 2024

Type

docx

Pages

2

Uploaded by kmkmkmkmkmkmkmkm

Report
Name: __________________________ Student #: ___________________ BIOL205: Tutorial #4 Worksheet 1. Complete the following table using a genetic codon table: 2 . Given a single template strand of DNA 3’-TAAATGTCAGCGATTTACGCCTTGCGAACT-5’ (a) Assuming transcription started at the beginning of this sequence, what mRNA chain which would be made from this strand. (b) what polypeptide chain would be made from this mRNA strand? 3. How many different mRNA's could specify the amino acid sequence met-phe- ser-pro-arg ? ( /1) 4. What is a gene? (a) Write a brief definition of what a gene is: (b) After discussion with the class, write a new definition if necessary: 5. The size of a haemoglobin coding region in humans is estimated to consist of approximately 450 nucleotide pairs. a) Estimate the size of the protein in amino acid residues. ( /1)
Name: __________________________ Student #: ___________________ b) Which is the most likely size of the gene? ( /1) i) 447 base pairs ii) 450 base pairs iii) 453 base pairs iv) 1000 base pairs 6. A) Given the following DNA sequence design 20 bp primers that would amplify the target sequence. ( /1) 5’AGGTGATCGATGCATCGTAC__Target sequence__TGATCGTATTAACCGTAGGG 3’ 3’TCCACTAGCTACGTAGCATG__Target sequence__ACTAGCATAATTGGCATCCC 5’ B) What is the approximate Tm of each primer? C) Do these primers fulfill the general primer design parameters? 7. What effect would the following mutations have on the PCR product above? i. Nonsense mutation in the target sequence: ii. Frameshift insertion mutation in the target sequence: iii. Frameshift deletion upstream of the primer sequence: iv. Indel in the primer sequence: v. Silent mutation in primer sequence: 8. The following gel was obtained from classic sanger sequencing. Determine the sequence of the DNA template. ( /1)
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help