ANAT.+PHYSIO.2-LAB.MAN. >CUSTOM<
20th Edition
ISBN: 9781264303090
Author: VanPutte
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.7, Problem 53AYP
Summary Introduction
To analyze:
The major changes that occur during physiological contracture and rigor mortis.
Introduction:
Fatigue is the process that usually occurs when the muscles undergo an anaerobic pathway to produce lactic acid which causes pain in the muscles. Immobility is also a characteristic feature of fatigue. The work capacity of the muscles gets reduced temporarily.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 9 Solutions
ANAT.+PHYSIO.2-LAB.MAN. >CUSTOM<
Ch. 9.1 - List and describe the functions performed by...Ch. 9.1 - State the functions of smooth and cardiac muscle...Ch. 9.1 - Using table 9.1, distinguish among skeletal,...Ch. 9.2 - Identify the four specialized functional...Ch. 9.2 - Outline the differences in control and function...Ch. 9.3 - Name the connective tissue layers that surround...Ch. 9.3 - What are motor neurons? How do the axons of motor...Ch. 9.3 - What is the origin of muscle fibers? How do you...Ch. 9.3 - What are T tubules and the sarcoplasmic reticulum?Ch. 9.3 - Prob. 10AYP
Ch. 9.3 - Prob. 11AYPCh. 9.3 - Prob. 12AYPCh. 9.3 - Prob. 13AYPCh. 9.3 - Prob. 14AYPCh. 9.3 - Prob. 15AYPCh. 9.3 - Prob. 16AYPCh. 9.3 - Prob. 17AYPCh. 9.4 - What type of ion channel contributes to the...Ch. 9.4 - What are the two types of gated ion channels in...Ch. 9.4 - Prob. 20AYPCh. 9.4 - Prob. 21AYPCh. 9.4 - List the two types of voltage-gated channels the...Ch. 9.4 - Prob. 23AYPCh. 9.4 - Prob. 24AYPCh. 9.4 - Prob. 25AYPCh. 9.4 - Prob. 26AYPCh. 9.4 - Describe the structure of a neuromuscular...Ch. 9.4 - Prob. 28AYPCh. 9.4 - Prob. 29AYPCh. 9.4 - Prob. 30AYPCh. 9.4 - Prob. 31AYPCh. 9.4 - What ion is necessary for movement of the...Ch. 9.4 - Describe the steps in cross-bridge cycling. How is...Ch. 9.4 - Prob. 34AYPCh. 9.5 - List the phases of a muscle twitch, and describe...Ch. 9.5 - Prob. 36AYPCh. 9.5 - Prob. 37AYPCh. 9.5 - Prob. 38AYPCh. 9.5 - Prob. 39AYPCh. 9.5 - How does the lack of on unresponsive period in...Ch. 9.5 - Distinguish between active tension and passive...Ch. 9.5 - Prob. 42AYPCh. 9.5 - Prob. 43AYPCh. 9.5 - What is muscle tone, and how is it maintained?Ch. 9.6 - Contrast the structural and physiological...Ch. 9.6 - Prob. 46AYPCh. 9.6 - Prob. 47AYPCh. 9.6 - What factors contribute to increases in muscle...Ch. 9.6 - Prob. 49AYPCh. 9.6 - Prob. 50AYPCh. 9.7 - What is fatigue? List the three locations where...Ch. 9.7 - Prob. 52AYPCh. 9.7 - Prob. 53AYPCh. 9.7 - List the energy sources used to synthesize ATP for...Ch. 9.7 - Prob. 55AYPCh. 9.7 - Prob. 56AYPCh. 9.7 - Prob. 57AYPCh. 9.7 - Prob. 58AYPCh. 9.8 - Describe a typical smooth muscle cell. How do its...Ch. 9.8 - Prob. 60AYPCh. 9.8 - Prob. 61AYPCh. 9.8 - Compare visceral smooth muscle and multiunit...Ch. 9.8 - Prob. 63AYPCh. 9.8 - Prob. 64AYPCh. 9.8 - How are spontoneous contractions produced in...Ch. 9.8 - Prob. 66AYPCh. 9.8 - Prob. 67AYPCh. 9.8 - Prob. 68AYPCh. 9.9 - Prob. 69AYPCh. 9.9 - Prob. 70AYPCh. 9.10 - Prob. 71AYPCh. 9 - Which of these is true of skeletal muscle? a....Ch. 9 - Prob. 2RACCh. 9 - Prob. 3RACCh. 9 - Each myofibril Is made up of many muscle fibers....Ch. 9 - Prob. 5RACCh. 9 - Which of these statements about the molecular...Ch. 9 - Prob. 7RACCh. 9 - Prob. 8RACCh. 9 - Prob. 9RACCh. 9 - Prob. 10RACCh. 9 - Prob. 11RACCh. 9 - Prob. 12RACCh. 9 - Prob. 13RACCh. 9 - With stimuli of increasing strength, which of...Ch. 9 - Considering the force of contraction of a skeletal...Ch. 9 - Which of these events occurs during the lag...Ch. 9 - Prob. 17RACCh. 9 - Prob. 18RACCh. 9 - Given the conditions: (1) low ATP levels (2)...Ch. 9 - Prob. 20RACCh. 9 - Prob. 21RACCh. 9 - Prob. 22RACCh. 9 - Prob. 23RACCh. 9 - Prob. 24RACCh. 9 - Which of these statements concerning aging and...Ch. 9 - Prob. 1CTCh. 9 - A patient is thought to be suffering from either...Ch. 9 - Design an experiment to test the following...Ch. 9 - Explain what is happening at the level of...Ch. 9 - Predict the shape of an active tension curve for...Ch. 9 - Prob. 6CTCh. 9 - Prob. 7CTCh. 9 - Prob. 8CTCh. 9 - Prob. 9CTCh. 9 - Prob. 10CTCh. 9 - Prob. 11CTCh. 9 - Prob. 12CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeLifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage
Types of Human Body Tissue; Author: MooMooMath and Science;https://www.youtube.com/watch?v=O0ZvbPak4ck;License: Standard YouTube License, CC-BY