EP CAMPBELL BIO.IN FOCUS AP-MOD.MASTER.
3rd Edition
ISBN: 9780137453092
Author: Urry
Publisher: SAVVAS L
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.3, Problem 1CC
Summary Introduction
To identify:
The reason why the nuclei resulting from experiment 2 contain different amount of DNA, as refer to Figure: 9.14 “Inquiry”, in the textbook.
Introduction:
With reference to the data in Figure: 9.14 “Inquiry”, in the textbook, the researchers investigated that “a cell’s progression by the cell cycle is controlled by cytoplasmic molecules”.
As given in experiment 2, researchers cause the fusion of M phase with a cell of G1 phase. The G1 phase began to start mitosis. This process resulted in the formation of a spindle and condensation of the chromosomes even though the chromosome had not been duplicated.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ?
5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’
this is a hypothetical example. In a real experiment
Choose
5’ TGAC 3’
5’ CTAT 3’
5’ ACTG 3’
5’ ATAG 3’
Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
In Figure 10-14, why does DNA migrate to the anode(+ pole)?
Since DNA is a hydrophillicmoelcule, it cannot pass through cell membranes. Name and explain the technique with which the DNA is forced into (ii) a bacterial cell (ii) a plant cell (iii) an animal cell.
Chapter 9 Solutions
EP CAMPBELL BIO.IN FOCUS AP-MOD.MASTER.
Ch. 9.1 - How many chromosomes are drawn in each part of...Ch. 9.1 - WHAT IF? A chicken has 78 chromosomes in its...Ch. 9.2 - How many chromosomes are shown in the drawing in...Ch. 9.2 - Compare cytokinesis in animal cells and plant...Ch. 9.2 - Prob. 3CCCh. 9.2 - Compare the roles of tubulin and actin during...Ch. 9.3 - Prob. 1CCCh. 9.3 - Prob. 2CCCh. 9.3 - Compare and contrast a benign tumor and a...Ch. 9.3 - Prob. 4CC
Ch. 9 - Through a microscope, you can see a cell plate...Ch. 9 - In the cells of some organisms, mitosis occurs...Ch. 9 - Which of the following does not occur during...Ch. 9 - Cell A has half as much DNA as cells B, C, and...Ch. 9 - The drug cytochalasin B blocks the function of...Ch. 9 - DRAW IT Draw one eukaryotic chromosome as it would...Ch. 9 - The light micrograph shows dividing cells near the...Ch. 9 - SCIENTIFIC INQUIRY Although both ends of a...Ch. 9 - FOCUS ON EVOLUTION The result of mitosis is that...Ch. 9 - FOCUS ON INFORMATION The continuity of life is...Ch. 9 - SYNTHESIZE YOUR KNOWLEDGE Shown here are two He La...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In John Gurdon's nuclear-transfer experiments, he used nuclei from tadpole intestinal cells. Do you think he would have had more success or less success if he had taken cells from a blastula? From an adult frog? Please briefly justify your answersarrow_forwardFrom a hospital patient affected with a mysterious illness, cells were isolated, cultured and purified its DNA. The DNA samples obtained from the cultures contain 2 different DNA, a double strand and a single strand viral DNA. The base composition of the 2 purified DNA samples were the following result: Which test tube is the human DNA present? Justify your answer.arrow_forwardQuestion Answer _9. Which statements best describe the relationship between the terms chromosomes, genes, and nuclei? 1) Chromosomes are found on genes. Genes are found in nuclei. 2) Chromosomes are found in nuclei. Nuclei are found in genes. 3) Genes are found on chromosomes. Chromosomes are found in nuclei. 4) Genes are found in nuclei. Nuclei are found in chromosomes. 13. A single gene mutation results from 1) a change in a base sequence in DNA 2) recombination of traits 3) the failure of chromosomes to separate 4) blocked nerve messages 16. Oddly shaped red blood cells and severe pain are characteristics of a human genetic disorder known as 1) hemophilia 2) Tay-Sachs disease 3) phenylketonuria 4) sickle-cell anemiaarrow_forward
- At the end of an experiment, you extract DNA from ten yeast colonies. You divide the DNA from each colony into two tubes, and send all twenty samples for sequencing. How many experimental replicates do you have?arrow_forwardSuppose the experiment of Meselson and Stahl was performed on a sample of 8 cells, each containing one copy of its circular double-stranded DNA genome, and that had been growing on normal 14N medium. You then grew the cells for 3 generations in medium containing 15N. The outcome would be A) 8 cells with single-stranded DNA molecules with 14N, and 24 cells with single-stranded DNA molecules with 15N. B) 16 cells with double-stranded DNA molecules with equal amounts of 14N and 15N, and 48 cells with double-stranded DNA molecules with 15N. C) 8 cells with double-stranded DNA molecules with equal amounts of 14N and 15N, and 24 cells with double-stranded DNA molecules with 15N. D) 8 cells with double-stranded DNA molecules with equal amounts of 14N and 15N, and 32 cells with double-stranded DNA molecules with 15N. E) 65 cells with single-stranded DNA molecules with 15N.arrow_forwardPick all that are true In the 1940s, DNA was established as the molecule of heredity in experiments using the bacterium S. pneumoniae. The experiment showed that growing a non-infective strain of S. pneumoniae in the presence of macerated cellular material (i.e. lysed cells) from an infective strain of S. pneumoniae could render the non-infective strain infective. The previously non-infective cell gained a new gene through this experiment, which made it infective. This is an example of: Transduction Horizontal gene transfer Conjugation Antibiotic resistance Transportation Transformationarrow_forward
- 5) Below is an image that shows both reproductive and therapeutic cloning. Use this image to answer compare and contrast therapeutic and reproductive cloning. Are they used for similar means…etc. Once you have done that answer the question below. a) There are two types of therapeutic cloning. What are they and how are they different?arrow_forwardQuestion 8. What method can be used to compare the transcriptomes of individual single cells?arrow_forwardIn the Hershey–Chase experiment, the radioactive label 32P was present inside bacterial cells (i.e., in the pellet), whereas the radioactive label 35S waspresent outside bacterial cells (in the supernatant). What would the researchers have concluded had the reverse been true, that is, if the radioactive label 35S were inside the cells and the radioactive label 32P were outside the cells?arrow_forward
- Can you fill in the blanks please.arrow_forwardNeema wants to determine whether or not the nucleus of a cell differs in the chemical compounds they contain or not from species to species. She is planning on working with the nucleus of a human and the nucleus of a mouse. She has removed all of the DNA from each nucleus, then has selected and isolated one DNA fragment from each species. What results can Neema expect if she takes the human DNA fragment and inserts it into the mouse nucleus and then inserts the mouse DNA fragment into the human nucleus? Use your knowledge of DNA replication to answer.arrow_forwardImagine that you repeat the DNA extraction, PCR, and gel electrophoresis experiment using Unknown Student A and B's DNA. After imaging the resulting gel, only the band representing the amylase gene fragment is present in Lane 2 of the gel in Figure 4.6. You do not observe a band for the actin gene fragment in Lane 2, but you do observe an actin band in the samples in Lanes 3, 4, and 5. All four lanes 2-5 have the amylase band. What could possibly explain why you do not see a band for actin in lane 2?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning