Biology: Science for Life with Physiology (5th Edition)
5th Edition
ISBN: 9780321922212
Author: Colleen Belk, Virginia Borden Maier
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 9, Problem 3AAATB
Summary Introduction
To write:
The site at which the restriction enzymes cuts the DNA.
Introduction:
Genome is defined as the complete genetic material that is present in an organism. It consists of the coding as well as the non-coding parts of DNA. The study of the genome is termed as genomics. Restriction enzymes are widely used enzymes in the field of genomics. This enzyme was discovered by three scientists named “Werner Arber, Hamilton Smith, and Daniel Nathans”.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
List the sequences of RNA that would be transcribed from the following DNA template sequences.
TTACACTTGCTTGAGAGTC
ACTTGGGCTATGCTCATTA
GGCTGCAATAGCCGTAGAT
GGAATACGTCTAGCTAGCA
Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the cDNA, mRNA, tRNA anticodons, and Give the amino acid sequence. What are the three possible outcomes if a Base Substitution mutation were to occur to the template?
For the DNA sequence shown, indicate the products of its cleavage with the following restriction endonucleases (AKA restriction enzymes):5′-ACAGCTGATTCGAATTCACGTT-3′3′-TGTCGACTAAGCTTAAGTGCAA-5′a) EcoRI (the recognition sequence and cleavage site is G↓AATTC);b) AluI (the recognition sequence and cleavage site is AG↓CT).
Chapter 9 Solutions
Biology: Science for Life with Physiology (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCGarrow_forwardYou plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the plasmid vector pUC19 illustrated below. You PCR amplify only the 184 bp DNA region representing exon 11 of HEXA from human DNA as a blunt-ended dsDNA fragment, and purify the amplicon. Next you digest the vector pUC19 with the restriction enzyme (RE) Smal to obtain linear plasmid DNA. You mix the PCR product and linear plasmid, add some DNA ligase enzyme in an appropriate buffer, and incubate overnight at 16°C. The ligation mixture is used to transform competent E. coli cells, which are subsequently streaked out onto agar plates containing ampicillin, X-gal and IPTG. HEXA exon 11 sequence: attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtc accaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaag gatttctacatagtggaacccctggcatttgaag PUC 19 plasmid map: 2686 1 Amp 0 lacZ EcoRI (390) Smal (410) BamHI (420) MCS Kpnl (430) LacR binding site Plac Pstl…arrow_forwardDefine about Alu family (the name is based on the presence of DNA sequences recognized by the restriction endonuclease AluI)arrow_forward
- The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forwardFor the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCCarrow_forwardWrite the base sequence of the DNA template from whichthis RNA sequence was derived: GUAUCAAUGAACUUG.How many amino acids are coded for in this sequence?arrow_forward
- Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’arrow_forwardFor Pet41 (choose Pet41 a, b, or c as provided in the image) how would you design the primers (forward and reverse) for the following gene of interest and what restriction enzymes would be used (as shown in the image)? Be sure to explain and elaborate on why selected and how. Gene of Interest: atgggc gacaaaggga 241 cccgagtgtt caagaaggcc agtccaaatg gaaagctcac cgtctacctg ggaaagcggg 301 actttgtgga ccacatcgac ctcgtggacc ctgtggatgg tgtggtcctg gtggatcctg 361 agtatctcaa agagcggaga gtctatgtga cgctgacctg cgccttccgc tatggccggg 421 aggacctgga tgtcctgggc ctgacctttc gcaaggacct gtttgtggcc aacgtacagt 481 cgttcccacc ggcccccgag gacaagaagc ccctgacgcg gctgcaggaa cgcctcatca 541 agaagctggg cgagcacgct taccctttca cctttgagat ccctccaaac cttccatgtt 601 ctgtgacact gcagccgggg cccgaagaca cggggaaggc ttgcggtgtg gactatgaag 661 tcaaagcctt ctgcgcggag aatttggagg agaagatcca caagcggaat tctgtgcgtc 721 tggtcatccg gaaggttcag tatgccccag agaggcctgg cccccagccc acagccgaga 781 ccaccaggca gttcctcatg tcggacaagc ccttgcacct…arrow_forwardWhat restriction enzyme (or enzymes) would you use to cut the following... (Gene of Interest is Bolded) 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…arrow_forward
- Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.arrow_forwardTable 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.arrow_forwardDecide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheaderarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY