The amino acid sequence produced from the mRNA nucleotide sequence CAACGCAUUUUG. Introduction: The mRNA consists of many bases. A collection of three bases that has the capability to code for a particular amino acid is called codon. Codons are present in the mRNA. These codons attach with the anticodon part of tRNA to synthesize amino acid. The anticodon part of tRNA is complementary to the codon part of mRNA. As a result, these two join together and undergo a process called translation to produce amino acids.

Question

Want to see the full answer?

Answer 1

Question

Chapter 9, Problem 2LTB

Summary Introduction

To write:

The amino acid sequence produced from the mRNA nucleotide sequence CAACGCAUUUUG.

Introduction:

The mRNA consists of many bases. A collection of three bases that has the capability to code for a particular amino acid is called codon. Codons are present in the mRNA. These codons attach with the anticodon part of tRNA to synthesize amino acid. The anticodon part of tRNA is complementary to the codon part of mRNA. As a result, these two join together and undergo a process called translation to produce amino acids.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

The following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.

The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?

Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA that would translate the synthesis of the following pentapeptide:Arg · Ile · Cys · Tyr · Val