Foundations in Microbiology
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
Question
Book Icon
Chapter 8.3, Problem 20CYP
Summary Introduction

To discuss:

Why does the total of ATPs generated differ between bacteria and eukaryotes.

Introduction:

Carriers in the electron transport chain like NADH coenzyme Q reductase etc accepts electrons from the Krebs cycle electron carrier nicotinamide adenine dinucleotide (NADH), and passes them to coenzyme Q (ubiquinone) which also receives electrons from complex II (succinate dehydrogenase ). Depending upon the types and stages involved in the electron transport chain by these carriers, there is a difference in the consumption of ATP between prokaryotes and eukaryotes.

Blurred answer
Students have asked these similar questions
Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA  5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
The Z value of LOD for two genes is 4, what  does it mean for linkage and inheritance?

Chapter 8 Solutions

Foundations in Microbiology

Ch. 8.1 - 4. Show diagrammatically the interaction of...Ch. 8.1 - 5. Differentiate among the chemical composition...Ch. 8.1 - 6. Summarize the direct and indirect controls that...Ch. 8.2 - Prob. 8ELOCh. 8.2 - 9. Describe biological oxidation-reduction and...Ch. 8.2 - Prob. 10ELOCh. 8.2 - 7. Explain how oxidation of a substrate proceeds...Ch. 8.2 - 8. Refer to the blue redox equation for...Ch. 8.2 - 9. In the following redox pairs, which compound is...Ch. 8.2 - 10. a. Describe the roles played by ATP and NAD+...Ch. 8.2 - Prob. 11CYPCh. 8.2 - 12. What is meant by the concept of the “final...Ch. 8.3 - 11. Relate the main points of bioenergetics and...Ch. 8.3 - 12. Describe the main catabolic pathways and their...Ch. 8.3 - 13. Define glycolysis and explain its input and...Ch. 8.3 - Prob. 14ELOCh. 8.3 - 15. Describe the components of the respiratory...Ch. 8.3 - 16. Explain the chemiosmotic mechanism of ATP...Ch. 8.3 - 17. Summarize the results of aerobic respiration.Ch. 8.3 - Prob. 18ELOCh. 8.3 - 13. Describe the basic energy strategies of...Ch. 8.3 - Prob. 14CYPCh. 8.3 - 15. Outline the basic steps in glycolysis,...Ch. 8.3 - Prob. 16CYPCh. 8.3 - 17. What is the fate of NADH in a fermentative...Ch. 8.3 - 18. Summarize the chemiosmotic theory of ATP...Ch. 8.3 - 19. Haw many ATPs could theoretically be formed...Ch. 8.3 - Prob. 20CYPCh. 8.3 - 21. Name the sources of oxygen in bacteria that...Ch. 8.3 - 22. What are the final electron acceptors in...Ch. 8.3 - Prob. 23CYPCh. 8.4 - 19. Explain what is meant by the term fermentation...Ch. 8.4 - 20. Describe some of the processes of fermentation...Ch. 8.4 - 24. What adaptive advantages does a fermentative...Ch. 8.4 - 25. Describe three patterns of fermentation...Ch. 8.5 - 21. Explain how cells perform anabolic functions...Ch. 8.5 - 22. Identify major pathways where molecules can be...Ch. 8.5 - 23. Briefly describe several mechanisms in...Ch. 8.5 - 26. What is meant by amphibolism, and what are its...Ch. 8.5 - Prob. 27CYPCh. 8.5 - 28. Which macromolecules are synthesized by...Ch. 8.6 - 24. Outline the general reactions of...Ch. 8.6 - 25. Describe the pigment systems and how they...Ch. 8.6 - 26. Describe the main events in the...Ch. 8.6 - 27. Describe the main events in the...Ch. 8.6 - 29. Indicate whether each of the following is...Ch. 8.6 - Prob. 30CYPCh. 8.6 - 31. What are the functions of chlorophyll and the...Ch. 8.6 - Prob. 32CYPCh. 8.6 - 33. Compare oxygenic with nonoxygenic...Ch. 8.L1 - 1. ______ is another term for biosynthesis. a....Ch. 8.L1 - Prob. 2MCQCh. 8.L1 - 3. An enzyme ___________ the activation energy...Ch. 8.L1 - 4. An enzyme a. becomes part of the final products...Ch. 8.L1 - 5. An apoenzyme is where the ___________ is...Ch. 8.L1 - 6. Many coenzymes contain a. metals b. vitamins c....Ch. 8.L1 - 7. To digest cellulose in its environment, a...Ch. 8.L1 - 8. Energy in biological systems is primarily a....Ch. 8.L1 - 9. Energy is carried from catabolic to anabolic...Ch. 8.L1 - 10. Exergonic reactions a. release potential...Ch. 8.L1 - Prob. 11MCQCh. 8.L1 - Prob. 12MCQCh. 8.L1 - Prob. 13MCQCh. 8.L1 - 14. Fermentation of a glucose molecule has the...Ch. 8.L1 - Prob. 15MCQCh. 8.L1 - Prob. 16MCQCh. 8.L1 - 17. The FADH2 formed during the Krebs cycle enters...Ch. 8.L1 - 18. The proton motive force is the result of a....Ch. 8.L1 - Prob. 19MCQCh. 8.L1 - Prob. 20MCQCh. 8.L1 - 21. The oxygen produced by photosynthesis comes...Ch. 8.L1 - Prob. 22MCQCh. 8.L1 - Prob. 1CSRCh. 8.L1 - Prob. 2CSRCh. 8.L1 - Prob. 3CSRCh. 8.L1 - Prob. 1WCCh. 8.L1 - 2. Give the general name of the enzyme a. converts...Ch. 8.L1 - 3. Explain what is unique about the actions of ATP...Ch. 8.L1 - Prob. 4WCCh. 8.L1 - 5. Describe four requirements required for...Ch. 8.L1 - Prob. 6WCCh. 8.L1 - Prob. 7WCCh. 8.L1 - Prob. 8WCCh. 8.L2 - 1. Use the following graph to diagram the...Ch. 8.L2 - 2. Explain what is meant by the “biochemical...Ch. 8.L2 - 3. Explain how it is possible for certain microbes...Ch. 8.L2 - 4. Suggest the advantages of having metabolic...Ch. 8.L2 - 5. Two steps in glycolysis are catalyzed by...Ch. 8.L2 - 6. Beer production requires an early period of...Ch. 8.L2 - 7. What would be the expected pHs of the matrix...Ch. 8.L2 - 8. At which site in the mitochondrion and...Ch. 8.L2 - Prob. 9CTCh. 8.L2 - Prob. 10CTCh. 8.L2 - 1. From chapter 7. figure 7.11 (reproduced below)....Ch. 8.L2 - 2. Look at the two figure parts (a) and (b) from...
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning