
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 8.3, Problem 20CYP
Summary Introduction
To discuss:
Why does the total of ATPs generated differ between bacteria and eukaryotes.
Introduction:
Carriers in the electron transport chain like NADH coenzyme Q reductase etc accepts electrons from the Krebs cycle electron carrier nicotinamide adenine dinucleotide (NADH), and passes them to coenzyme Q (ubiquinone) which also receives electrons from complex II (succinate dehydrogenase ). Depending upon the types and stages involved in the electron transport chain by these carriers, there is a difference in the consumption of ATP between prokaryotes and eukaryotes.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?
Chapter 8 Solutions
Foundations in Microbiology
Ch. 8.1 - 1. Define metabolism and differentiate its two...Ch. 8.1 - Prob. 2ELOCh. 8.1 - 3. outline the prominent characteristics of...Ch. 8.1 - 4. Explain how enzymes lower the energy required...Ch. 8.1 - 5. Discuss enzyme structure, and interactions...Ch. 8.1 - 6. Describe the types of enzyme functions and...Ch. 8.1 - 7. Summarize key features of enzyme regulation.Ch. 8.1 - 1. Differentiate between catabolism and anabolism...Ch. 8.1 - 2. Describe 10 important biochemical properties of...Ch. 8.1 - 3. Describe the chemistry of enzymes, and explain...
Ch. 8.1 - 4. Show diagrammatically the interaction of...Ch. 8.1 - 5. Differentiate among the chemical composition...Ch. 8.1 - 6. Summarize the direct and indirect controls that...Ch. 8.2 - Prob. 8ELOCh. 8.2 - 9. Describe biological oxidation-reduction and...Ch. 8.2 - Prob. 10ELOCh. 8.2 - 7. Explain how oxidation of a substrate proceeds...Ch. 8.2 - 8. Refer to the blue redox equation for...Ch. 8.2 - 9. In the following redox pairs, which compound is...Ch. 8.2 - 10. a. Describe the roles played by ATP and NAD+...Ch. 8.2 - Prob. 11CYPCh. 8.2 - 12. What is meant by the concept of the “final...Ch. 8.3 - 11. Relate the main points of bioenergetics and...Ch. 8.3 - 12. Describe the main catabolic pathways and their...Ch. 8.3 - 13. Define glycolysis and explain its input and...Ch. 8.3 - Prob. 14ELOCh. 8.3 - 15. Describe the components of the respiratory...Ch. 8.3 - 16. Explain the chemiosmotic mechanism of ATP...Ch. 8.3 - 17. Summarize the results of aerobic respiration.Ch. 8.3 - Prob. 18ELOCh. 8.3 - 13. Describe the basic energy strategies of...Ch. 8.3 - Prob. 14CYPCh. 8.3 - 15. Outline the basic steps in glycolysis,...Ch. 8.3 - Prob. 16CYPCh. 8.3 - 17. What is the fate of NADH in a fermentative...Ch. 8.3 - 18. Summarize the chemiosmotic theory of ATP...Ch. 8.3 - 19. Haw many ATPs could theoretically be formed...Ch. 8.3 - Prob. 20CYPCh. 8.3 - 21. Name the sources of oxygen in bacteria that...Ch. 8.3 - 22. What are the final electron acceptors in...Ch. 8.3 - Prob. 23CYPCh. 8.4 - 19. Explain what is meant by the term fermentation...Ch. 8.4 - 20. Describe some of the processes of fermentation...Ch. 8.4 - 24. What adaptive advantages does a fermentative...Ch. 8.4 - 25. Describe three patterns of fermentation...Ch. 8.5 - 21. Explain how cells perform anabolic functions...Ch. 8.5 - 22. Identify major pathways where molecules can be...Ch. 8.5 - 23. Briefly describe several mechanisms in...Ch. 8.5 - 26. What is meant by amphibolism, and what are its...Ch. 8.5 - Prob. 27CYPCh. 8.5 - 28. Which macromolecules are synthesized by...Ch. 8.6 - 24. Outline the general reactions of...Ch. 8.6 - 25. Describe the pigment systems and how they...Ch. 8.6 - 26. Describe the main events in the...Ch. 8.6 - 27. Describe the main events in the...Ch. 8.6 - 29. Indicate whether each of the following is...Ch. 8.6 - Prob. 30CYPCh. 8.6 - 31. What are the functions of chlorophyll and the...Ch. 8.6 - Prob. 32CYPCh. 8.6 - 33. Compare oxygenic with nonoxygenic...Ch. 8.L1 - 1. ______ is another term for biosynthesis. a....Ch. 8.L1 - Prob. 2MCQCh. 8.L1 - 3. An enzyme ___________ the activation energy...Ch. 8.L1 - 4. An enzyme a. becomes part of the final products...Ch. 8.L1 - 5. An apoenzyme is where the ___________ is...Ch. 8.L1 - 6. Many coenzymes contain a. metals b. vitamins c....Ch. 8.L1 - 7. To digest cellulose in its environment, a...Ch. 8.L1 - 8. Energy in biological systems is primarily a....Ch. 8.L1 - 9. Energy is carried from catabolic to anabolic...Ch. 8.L1 - 10. Exergonic reactions a. release potential...Ch. 8.L1 - Prob. 11MCQCh. 8.L1 - Prob. 12MCQCh. 8.L1 - Prob. 13MCQCh. 8.L1 - 14. Fermentation of a glucose molecule has the...Ch. 8.L1 - Prob. 15MCQCh. 8.L1 - Prob. 16MCQCh. 8.L1 - 17. The FADH2 formed during the Krebs cycle enters...Ch. 8.L1 - 18. The proton motive force is the result of a....Ch. 8.L1 - Prob. 19MCQCh. 8.L1 - Prob. 20MCQCh. 8.L1 - 21. The oxygen produced by photosynthesis comes...Ch. 8.L1 - Prob. 22MCQCh. 8.L1 - Prob. 1CSRCh. 8.L1 - Prob. 2CSRCh. 8.L1 - Prob. 3CSRCh. 8.L1 - Prob. 1WCCh. 8.L1 - 2. Give the general name of the enzyme a. converts...Ch. 8.L1 - 3. Explain what is unique about the actions of ATP...Ch. 8.L1 - Prob. 4WCCh. 8.L1 - 5. Describe four requirements required for...Ch. 8.L1 - Prob. 6WCCh. 8.L1 - Prob. 7WCCh. 8.L1 - Prob. 8WCCh. 8.L2 - 1. Use the following graph to diagram the...Ch. 8.L2 - 2. Explain what is meant by the “biochemical...Ch. 8.L2 - 3. Explain how it is possible for certain microbes...Ch. 8.L2 - 4. Suggest the advantages of having metabolic...Ch. 8.L2 - 5. Two steps in glycolysis are catalyzed by...Ch. 8.L2 - 6. Beer production requires an early period of...Ch. 8.L2 - 7. What would be the expected pHs of the matrix...Ch. 8.L2 - 8. At which site in the mitochondrion and...Ch. 8.L2 - Prob. 9CTCh. 8.L2 - Prob. 10CTCh. 8.L2 - 1. From chapter 7. figure 7.11 (reproduced below)....Ch. 8.L2 - 2. Look at the two figure parts (a) and (b) from...
Knowledge Booster
Similar questions
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Biology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forwardUnit Conversions: If the field of view at 10x is 3.1x106 µm2, what would it be in mm2. Report your answer with 2 significant digits. 1 mm = 1000 µm. Include units in your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning