EP CONNECT ONLINE ACCESS FOR BIOLOGY:
5th Edition
ISBN: 9781260542226
Author: Hoefnagels
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Question
Chapter 8, Problem 9WIO
Summary Introduction
To determine:
The mutation in the gene encoding p53 be associated with high risk for cancer.
Concept Introduction:
Gene p53 is also called as the tumor protein that code for a protein that regulates the cell cycle and thus, functions as tumor suppression. It plays an important role in multicellular organisms to suppress cancer. This gene is located on the seventeenth chromosomes. It is the phosphorylated protein made up of 393 amino acids.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 8 Solutions
EP CONNECT ONLINE ACCESS FOR BIOLOGY:
Ch. 8.1 - Explain the roles of mitotic cell division,...Ch. 8.1 - Prob. 2MCCh. 8.2 - Prob. 1MCCh. 8.2 - Prob. 2MCCh. 8.2 - Prob. 3MCCh. 8.2 - Prob. 4MCCh. 8.3 - Which cell types divide by binary fission?Ch. 8.3 - Prob. 2MCCh. 8.4 - Prob. 1MCCh. 8.4 - Prob. 2MC
Ch. 8.5 - Prob. 1MCCh. 8.5 - Prob. 2MCCh. 8.5 - Prob. 3MCCh. 8.5 - Prob. 4MCCh. 8.5 - Distinguish between mitosis and cytokinesis.Ch. 8.6 - Prob. 1MCCh. 8.6 - Prob. 2MCCh. 8.6 - Prob. 3MCCh. 8.6 - Prob. 4MCCh. 8.6 - Prob. 5MCCh. 8.7 - Prob. 1MCCh. 8.7 - Prob. 2MCCh. 8.8 - Prob. 1MCCh. 8.8 - Prob. 2MCCh. 8 - A DNA molecule is placed in a test tube containing...Ch. 8 - Prob. 2MCQCh. 8 - Prob. 3MCQCh. 8 - Prob. 4MCQCh. 8 - Prob. 5MCQCh. 8 - Prob. 1WIOCh. 8 - Write and explain an analogy for each of these DNA...Ch. 8 - Obtain a rubber band and twist it as m any times...Ch. 8 - Sketch and describe the events that occur when a...Ch. 8 - Prob. 5WIOCh. 8 - List the ways that binary fission is similar to...Ch. 8 - Prob. 7WIOCh. 8 - Prob. 8WIOCh. 8 - Prob. 9WIOCh. 8 - Prob. 1PITCh. 8 - Prob. 2PITCh. 8 - Prob. 3PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
What are Mutations and what are the different types of Mutations?; Author: Science ABC;https://www.youtube.com/watch?v=I16YlE8qTBU;License: Standard youtube license