
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8, Problem 7RQ
Summary Introduction
To determine:
The importance of oxygen in
Introduction:
Cellular respiration always takes place in the presence of oxygen and it generates 17 times as much ATP as the glycolysis does. The stage one of cellular respiration is accompanied by the formation of acetyl CoA and Kreb's cycle. The second stage of cellular respiration involves the electron transport chain and chemiosmosis. In cellular respiration glucose and other molecules are broken down and the energy liberated is used to make ATP.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 8 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 8.1 - explain how photosynthesis and glucose breakdown...Ch. 8.1 - summarize glucose breakdown in the presence and...Ch. 8.2 - explain the energy investment and...Ch. 8.2 - Prob. 2CYLCh. 8.2 - What is the net energy yield in ATP and NADH...Ch. 8.3 - How would the rate of ATP production be affected...Ch. 8.3 - Cyanide is a favorite poison in old murder...Ch. 8.3 - Raising a King The mitochondrial DNA (mtDNA) that...Ch. 8.3 - summarize the two major stages of cellular...Ch. 8.3 - explain how ATP is generated by chemiosmosis?
Ch. 8.3 - describe the role of oxygen in cellular...Ch. 8.4 - Colin, a 45-year-old obese man, comes to you, his...Ch. 8.4 - What would happen if cells were prevented from...Ch. 8.4 - Prob. 1CSCCh. 8.4 - Jeremy has always had difficulty walking rapidly...Ch. 8.4 - explain the function of fermentation and the...Ch. 8.4 - Prob. 2CYLCh. 8.4 - list some examples of human uses of each type of...Ch. 8 - Which of the following is True for one glucose...Ch. 8 - Prob. 2MCCh. 8 - Prob. 3MCCh. 8 - Prob. 4MCCh. 8 - Prob. 5MCCh. 8 - Prob. 1FIBCh. 8 - Prob. 2FIBCh. 8 - Prob. 3FIBCh. 8 - Prob. 4FIBCh. 8 - Prob. 5FIBCh. 8 - Prob. 1RQCh. 8 - Draw and label a mitochondrion, and explain how...Ch. 8 - What role do the following play in breaking down...Ch. 8 - Prob. 4RQCh. 8 - Prob. 5RQCh. 8 - Prob. 6RQCh. 8 - Prob. 7RQCh. 8 - Compare the structure of chloroplasts (described...Ch. 8 - Some species of bacteria use aerobic respiration,...Ch. 8 - Prob. 2ACCh. 8 - Prob. 3ACCh. 8 - Some species of bacteria that live at the surface...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Microbial Nutrition and Growth; Author: Scientist Cindy;https://www.youtube.com/watch?v=rK3UkyWjkl8;License: Standard YouTube License, CC-BY