Lehninger Principles of Biochemistry
Lehninger Principles of Biochemistry
7th Edition
ISBN: 9781464126116
Author: David L. Nelson, Michael M. Cox
Publisher: W. H. Freeman
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 8, Problem 7P
Summary Introduction

To determine: Whether the melting temperature will be higher or lower if an RNA duplex oligonucleotide with sequence UAAUACGACUCACUAUAGGG is constructed.

Concept introduction:

At higher melting temperature DNA undergoes denaturation as doubles strands are broken down into single strands. The melting temperature of DNA molecules depend on the content of GC, length of DNA, nucleotide sequences, and stability of DNA molecule. Stability of DNA is determined by interactions between bases, between bases and water and base stacking interactions within adjacent bases.

Blurred answer
Students have asked these similar questions
2. For the flow of fluid over a flat membrane of length 10cm, determine the length-average mass transfer coefficient. The relevant properties of the system are u=0.01cm²/s, D=5 x 106 cm²/s, and v = 5.0 cm/s.
Background Freezing isn't the only challenge in cryopreservation - thawing can be just as difficult. A microwave oven seems like a nice solution, since it deposits energy quickly and microwaves are non-ionizing radiation (they do not cause DNA mutation). However, water absorbs microwaves more effectively than ice does, meaning that the portion of an organ that has already melted will get warmer at a higher rate than the remaining ice – the opposite of what we want! - The transmission of radiation through a weakly absorbing material such as ice or water can be modeled by Beer's law, which assumes that the rate of absorption at a depth x is proportional to the local radiation intensity I(x) times an absorption coefficient, which is often written as μ or a or just µ). Noting that absorption decreases the intensity, we can write a differential equation a Solving the differential equation with the boundary condition on the surface being gives the relationship For a standard microwave oven…
3. Dry air is inhaled at a rate of 10 liter/min through a trachea with a diameter of 20 mm and a length of 125 mm. The inner surface of the trachea is at a normal body temperature of 37°C and may be assumed to be saturated with water. a. Assuming steady, fully developed flow in the trachea, estimate the mass transfer convection coefficient. b. Estimate the daily water loss (liter/day) associated with evaporation in the trachea.
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Text book image
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Text book image
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Text book image
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license