Whether the melting temperature will be higher or lower if an RNA duplex oligonucleotide with sequence UAAUACGACUCACUAUAGGG is constructed. Concept introduction: At higher melting temperature DNA undergoes denaturation as doubles strands are broken down into single strands. The melting temperature of DNA molecules depend on the content of GC, length of DNA, nucleotide sequences, and stability of DNA molecule. Stability of DNA is determined by interactions between bases, between bases and water and base stacking interactions within adjacent bases.

Question

please draw it for me and tell me where i need to modify the structure

Answer 1

Question

Chapter 8, Problem 7P

Summary Introduction

To determine: Whether the melting temperature will be higher or lower if an RNA duplex oligonucleotide with sequence UAAUACGACUCACUAUAGGG is constructed.

Concept introduction:

At higher melting temperature DNA undergoes denaturation as doubles strands are broken down into single strands. The melting temperature of DNA molecules depend on the content of GC, length of DNA, nucleotide sequences, and stability of DNA molecule. Stability of DNA is determined by interactions between bases, between bases and water and base stacking interactions within adjacent bases.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Students have asked these similar questions

please draw it for me and tell me where i need to modify the structure

Please help determine the standard curve for my Kinase Activity in Excel Spreadsheet. Link: https://mnscu-my.sharepoint.com/personal/vi2163ss_go_minnstate_edu/_layouts/15/Doc.aspx?sourcedoc=%7B958f5aee-aabd-45d7-9f7e-380002892ee0%7D&action=default&slrid=9b178ea1-b025-8000-6e3f-1cbfb0aaef90&originalPath=aHR0cHM6Ly9tbnNjdS1teS5zaGFyZXBvaW50LmNvbS86eDovZy9wZXJzb25hbC92aTIxNjNzc19nb19taW5uc3RhdGVfZWR1L0VlNWFqNVc5cXRkRm4zNDRBQUtKTHVBQldtcEtWSUdNVmtJMkoxQzl3dmtPVlE_cnRpbWU9eEE2X291ZHIzVWc&CID=e2126631-9922-4cc5-b5d3-54c7007a756f&_SRM=0:G:93 Determine the amount of VRK1 is present 1. Average the data and calculate the mean absorbance for each concentration/dilution (Please over look for Corrections) 2. Blank Correction à Subtract 0 ug/mL blank absorbance from all readings (Please over look for Corrections) 3. Plot the Standard Curve (Please over look for Corrections) 4. Convert VRK1 concentration from ug/mL to g/L 5. Use the molar mass of VRK1 to convert to M and uM…

Macmillan Learning Cholesterol synthesis begins with the formation of mevalonate from acetyl CoA. This process activates mevalonate and converts it to isopentenyl pyrophosphate. Identify the atoms in mevalonate and isopentenyl pyrophosphate that will be labeled from acetyl CoA labeled with 14C in the carbonyl carbon. Place 14C atoms and C atoms to denote which carbon atoms are labeled and which are not labeled. H₂C COA 14C-labeled acetyl-CoA HHH [c] H H OH 014C - OH H HH H Mevalonate CH3 H H 14C H Η H H Incorrect Answer of o -P-O-P-0- Isopentenyl pyrophosphate с Answer Bank 14C