SaplingPlus for Lehninger Principles of Biochemistry (Six-Month Access)
SaplingPlus for Lehninger Principles of Biochemistry (Six-Month Access)
7th Edition
ISBN: 9781319108236
Author: David L. Nelson, Michael M. Cox
Publisher: W. H. Freeman
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 8, Problem 7P
Summary Introduction

To determine: Whether the melting temperature will be higher or lower if an RNA duplex oligonucleotide with sequence UAAUACGACUCACUAUAGGG is constructed.

Concept introduction:

At higher melting temperature DNA undergoes denaturation as doubles strands are broken down into single strands. The melting temperature of DNA molecules depend on the content of GC, length of DNA, nucleotide sequences, and stability of DNA molecule. Stability of DNA is determined by interactions between bases, between bases and water and base stacking interactions within adjacent bases.

Blurred answer
Students have asked these similar questions
MISSED THIS? Read Section 19.9 (Pages 878-881); Watch IWE 19.10 Consider the following reaction: CH3OH(g) CO(g) + 2H2(g) (Note that AG,CH3OH(g) = -162.3 kJ/mol and AG,co(g)=-137.2 kJ/mol.) Part A Calculate AG for this reaction at 25 °C under the following conditions: PCH₂OH Pco PH2 0.815 atm = 0.140 atm 0.170 atm Express your answer in kilojoules to three significant figures. Ο ΑΣΦ AG = -150 Submit Previous Answers Request Answer □? kJ × Incorrect; Try Again; 2 attempts remaining Calculate the free energy change under nonstandard conditions (AGrxn) by using the following relationship: AGrxn = AGrxn + RTInQ, AGxn+RTInQ, where AGxn is the standard free energy change, R is the ideal gas constant, T is the temperature in kelvins, a is the reaction quotient. Provide Feedback Next >
Identify and provide a brief explanation of Gas Chromatography (GC) within the context of chemical analysis of food. Incorporate the specific application name, provide a concise overview of sample preparation methods, outline instrumental parameters and conditions ultilized, and summarise the outcomes and findings achieved through this analytical approach.
Identify and provide a concise explanation of the concept of signal-to-noise ratio (SNR) in the context of chemical analysis. Provide specific examples.
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Chemistry
Chemistry
ISBN:9781305957404
Author:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste
Publisher:Cengage Learning
Text book image
Chemistry
Chemistry
ISBN:9781259911156
Author:Raymond Chang Dr., Jason Overby Professor
Publisher:McGraw-Hill Education
Text book image
Principles of Instrumental Analysis
Chemistry
ISBN:9781305577213
Author:Douglas A. Skoog, F. James Holler, Stanley R. Crouch
Publisher:Cengage Learning
Text book image
Organic Chemistry
Chemistry
ISBN:9780078021558
Author:Janice Gorzynski Smith Dr.
Publisher:McGraw-Hill Education
Text book image
Chemistry: Principles and Reactions
Chemistry
ISBN:9781305079373
Author:William L. Masterton, Cecile N. Hurley
Publisher:Cengage Learning
Text book image
Elementary Principles of Chemical Processes, Bind...
Chemistry
ISBN:9781118431221
Author:Richard M. Felder, Ronald W. Rousseau, Lisa G. Bullard
Publisher:WILEY
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license