Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 7P
The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, some genes are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
| a. | Asn at position 10 in protein A is changed to Tyr. |
| b. | Leu at position 12 in protein A is changed to Pro. |
| c. | Gln at position 8 in protein B is changed to Leu. |
| d. | The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Do cats fly without wings ?
Luke recently moved to a new apartment and wants to grow houseplants but isn't sure which room will be the best fit for them. Apply your knowledge of the scientific method to recommend a strategy for Luke to follow when determining the ideal location for houseplants in his new apartment.
A farmer has noticed that his soybean plants produce more beans in some years than others. He claims to always apply the same amount of fertilizer to the plants, but he suspects the difference in crop yield may have something to do with the amount of water the crops receive. The farmer has observed that the soybeans on his farm usually receive between 0 to 0.5 inches of water per day, but he is unsure of the optimal average daily amount of water with which to irrigate.
1. State a question that addresses the farmer’s problem
2. Conduct online research on “soybean crop irrigation" and record a brief summary of the findings
3. Construct a testable hypothesis and record i
4. Design an experiment to test the hypothesis and describe the procedures, variables, and data to be collected
5. What is the purpose of a control group in an experiment? What would the control groups be for each of your designed experiments in this exercise?
6. Describe the data that would be recorded in each of the…
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A farmer has noticed that his soybean plants produce more beans in some years than others. He claims to always apply the same amount of fertilizer to the plants, but he suspects the difference in crop yield may have something to do with the amount of water the crops receive. The farmer has observed that the soybeans on his farm usually receive between 0 to 0.5 inches of water per day, but he is unsure of the optimal average daily amount of water with which to irrigate. 1. State a question that addresses the farmer’s problem 2. Conduct online research on “soybean crop irrigation" and record a brief summary of the findings 3. Construct a testable hypothesis and record i 4. Design an experiment to test the hypothesis and describe the procedures, variables, and data to be collectedarrow_forwardA pharmaceutical company has developed a new weight loss drug for adults. Preliminary tests show that the drug seems to be fairly effective in about 75% of test subjects. The drug company thinks that the drug might be most effective in overweight individuals, but they are unsure to whom they should market the product. Use the scientific method to address the pharmaceutical company’s needs: State a research question that addresses the pharmaceutical company's problem Conduct online research on “Body Mass Index” categories and record a brief summary Construct a testable hypothesis and record in Design an experiment to test the hypothesis and describe the procedures, variables, and data to be collected What is the purpose of a control group in an experiment? What would the control groups be for each of your designed experiments in this exercise? Describe the data that would be recorded in each of the experiments you designed. Would it be classified as quantitative or…arrow_forwardPatients with multiple sclerosis frequently suffer from blurred vision. Drug X was developed to reduce blurred vision in healthy patients, but the effectiveness had not been tested on those suffering from multiple sclerosis. A study was conducted to determine if Drug X is effective at reducing blurry vision in multiple sclerosis patients. To be considered effective, a drug must reduce blurred vision by more than 30% in patients. Researchers predicted that a 20 mg dose of the drug would be effective for treating blurred vision in multiple sclerosis patients by reducing blurred vision by more than 30%. Drug X was administered to groups of multiple sclerosis patients at three doses (10 mg/day, 20 mg/day, 30 mg/day) for three weeks. A fourth group of patients was given a placebo containing no drug X for the same length of time. Vision clarity was measured for each patient before and after the three-week period using a standard vision test. The results were analyzed and graphed (See Figure…arrow_forward
- Svp je voulais demander l aide pour mon exercicearrow_forwardImagine that you are a clinical geneticist. Your colleague is an oncologist who wants your help explaining the basics of genetics to their patient, who will be undergoing genetic testing in the coming weeks for possible acute myeloid leukemia (AML) induced by the radiation she had several years ago for breast cancer. Write a 1,050- to 1,225-word memo to your colleague. Include the following in your memo: An explanation of the molecular structure of DNA and RNA, highlighting both similarities and differences A description of the processes of transcription and translation An explanation of the differences between leading and lagging strands and how the DNA is replicated in each strand Reponses to the following common questions patients might ask about this type of genetic testing and genetic disorder: Does AML run in families? What genes are tested for?arrow_forwardRespond to the following in a minimum of 175 words: What are some potential consequences that could result if the processes of replication, transcription, and translation don’t function correctly? Provide an example of how you might explain these consequences in terms that patients might understand.arrow_forward
- answer questions 1-10arrow_forwardAnswer Question 1-9arrow_forwardEx: Mr. Mandarich wanted to see if the color of light shined on a planthad an effect on the number of leaves it had. He gathered a group ofthe same species of plants, gave them the same amount of water, anddid the test for the same amount of time. Only the color of light waschanged. IV:DV:Constants:Control Gr:arrow_forward
- ethical considerations in medical imagingarrow_forwardPlease correct answer and don't used hand raiting and don't used Ai solutionarrow_forward2. In one of the reactions of the citric acid cycle, malate is oxidized to oxaloacetate. When this reaction is considered in isolation, a small amount of malate remains and is not oxidized. The best term to explain this is a. enthalpy b. entropy c. equilibrium d. free energy e. loss of energyarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY