
Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 33P
The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA.
5′ CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3′
3′ GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG 5′
a. | Which strand is the template strand? In which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? |
b. | What is the sequence of the |
c. | A single base mutation in the gene results in synthesis of the peptide Met Tyr Thr. What is the sequence of nucleotides making up the mRNA produced by this mutant gene? |
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Skip to main content
close
Homework Help is Here – Start Your Trial Now!
arrow_forward
search
SEARCH
ASK
Human Anatomy & Physiology (11th Edition)BUY
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
1 The Human Body: An Orientation
expand_moreChapter 1 : The Human Body: An Orientation
Chapter Questions
expand_moreSection: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
format_list_bulletedProblem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
Bartleby Related Questions Icon
Related questions
Bartleby Expand Icon
bartleby
Concept explainers
bartleby
Question
Draw a replication bubble with two replication forks.blue lines are DNA single strands and red lines are RNA single strands.indicate all 3' and 5’ ends on all DNA single…
Provide an answer
Question 4
1 pts
Which of the following would be most helpful for demonstrating alternative splicing for a
new organism?
○ its proteome and its transcriptome
only its transcriptome
only its genome
its proteome and its genome
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What did the Cre-lox system used in the Kikuchi et al. 2010 heart regeneration experiment allow researchers to investigate? What was the purpose of the cmlc2 promoter? What is CreER and why was it used in this experiment? If constitutively active Cre was driven by the cmlc2 promoter, rather than an inducible CreER system, what color would you expect new cardiomyocytes in the regenerated area to be no matter what? Why?arrow_forwardWhat kind of organ size regulation is occurring when you graft multiple organs into a mouse and the graft weight stays the same?arrow_forwardWhat is the concept "calories consumed must equal calories burned" in regrads to nutrition?arrow_forward
- You intend to insert patched dominant negative DNA into the left half of the neural tube of a chick. 1) Which side of the neural tube would you put the positive electrode to ensure that the DNA ends up on the left side? 2) What would be the internal (within the embryo) control for this experiment? 3) How can you be sure that the electroporation method itself is not impacting the embryo? 4) What would you do to ensure that the electroporation is working? How can you tell?arrow_forwardDescribe a method to document the diffusion path and gradient of Sonic Hedgehog through the chicken embryo. If modifying the protein, what is one thing you have to consider in regards to maintaining the protein’s function?arrow_forwardThe following table is from Kumar et. al. Highly Selective Dopamine D3 Receptor (DR) Antagonists and Partial Agonists Based on Eticlopride and the D3R Crystal Structure: New Leads for Opioid Dependence Treatment. J. Med Chem 2016.arrow_forward
- The following figure is from Caterina et al. The capsaicin receptor: a heat activated ion channel in the pain pathway. Nature, 1997. Black boxes indicate capsaicin, white circles indicate resinferatoxin. You are a chef in a fancy new science-themed restaurant. You have a recipe that calls for 1 teaspoon of resinferatoxin, but you feel uncomfortable serving foods with "toxins" in them. How much capsaicin could you substitute instead?arrow_forwardWhat protein is necessary for packaging acetylcholine into synaptic vesicles?arrow_forward1. Match each vocabulary term to its best descriptor A. affinity B. efficacy C. inert D. mimic E. how drugs move through body F. how drugs bind Kd Bmax Agonist Antagonist Pharmacokinetics Pharmacodynamicsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY