An operon is a functioning unit of the genomic DNA containing a cluster of genes under the control of a single promoter. Operon occurs primarily in prokaryotes but also in some eukaryotes, it is made up of several structural genes arranged under a common promoter and regulated by common operator.

Question

Want to see the full answer?

Answer 1

Question

Chapter 8, Problem 6MCQ

Summary Introduction

Introduction:

An operon is a functioning unit of the genomic DNA containing a cluster of genes under the control of a single promoter. Operon occurs primarily in prokaryotes but also in some eukaryotes, it is made up of several structural genes arranged under a common promoter and regulated by common operator.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 8, Problem 6MCQ

Summary Introduction

Introduction:

An operon is a functioning unit of the genomic DNA containing a cluster of genes under the control of a single promoter. Operon occurs primarily in prokaryotes but also in some eukaryotes, it is made up of several structural genes arranged under a common promoter and regulated by common operator.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 8, Problem 6MCQ

Summary Introduction

Introduction:

An operon is a functioning unit of the genomic DNA containing a cluster of genes under the control of a single promoter. Operon occurs primarily in prokaryotes but also in some eukaryotes, it is made up of several structural genes arranged under a common promoter and regulated by common operator.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 8, Problem 6MCQ

Summary Introduction

Introduction:

An operon is a functioning unit of the genomic DNA containing a cluster of genes under the control of a single promoter. Operon occurs primarily in prokaryotes but also in some eukaryotes, it is made up of several structural genes arranged under a common promoter and regulated by common operator.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 8, Problem 6MCQ

Summary Introduction

Introduction:

An operon is a functioning unit of the genomic DNA containing a cluster of genes under the control of a single promoter. Operon occurs primarily in prokaryotes but also in some eukaryotes, it is made up of several structural genes arranged under a common promoter and regulated by common operator.

Answer 6

Chapter 8, Problem 6MCQ

Summary Introduction

Introduction:

An operon is a functioning unit of the genomic DNA containing a cluster of genes under the control of a single promoter. Operon occurs primarily in prokaryotes but also in some eukaryotes, it is made up of several structural genes arranged under a common promoter and regulated by common operator.

Answer 7

Chapter 8, Problem 6MCQ

Summary Introduction

Introduction:

An operon is a functioning unit of the genomic DNA containing a cluster of genes under the control of a single promoter. Operon occurs primarily in prokaryotes but also in some eukaryotes, it is made up of several structural genes arranged under a common promoter and regulated by common operator.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 8.1 - Define the terms genome and gene.Ch. 8.1 - Prob. 1NP Ch. 8.1 - Differentiate between genotype and phenotype.Ch. 8.1 - Draw a segment of DNA, labeling all important...Ch. 8.1 - Summarize the steps of bacterial DNA replication,...Ch. 8.1 - Compare and contrast the synthesis of leading and...Ch. 8.2 - Prob. 10AYP Ch. 8.2 - Identify the locations of the promoter, the start...Ch. 8.2 - Indicate how eukaryotic transcription and...Ch. 8.2 - NCLEX PREP 2. The following are all true of RNA,...

An operon is a functioning unit of the genomic DNA containing a cluster of genes under the control of a single promoter. Operon occurs primarily in prokaryotes but also in some eukaryotes, it is made up of several structural genes arranged under a common promoter and regulated by common operator.

Solution Summary: The author explains that an operon is made up of several structural genes arranged under a common promoter and regulated by an operator.

Concept explainers

Videos

Want to see the full answer?

Chapter 8 Solutions