Concept explainers
To answer:
Recognition and restriction of DNA sequence by HhaI.
Introduction:
Restriction enzymes recognize and cut DNA
Want to see the full answer?
Check out a sample textbook solutionChapter 8 Solutions
Microbiology with Diseases by Body System (4th Edition)
- A short protein segment was cleaved by two different enzymes resulting in two sets of degradation products with multiple fragments in each set. The amino acid sequence of each fragment was determined via Edman degradation. The fragments obtained from Enzyme 1 have the following sequences: LLIGVVQT RKNS SFWAA EED Meanwhile, the fragments obtained from Enzyme 2 were found to have the following sequences: QTEED SSFWAALL IGVV RKN What is the amino acid sequence of the short protein segment from which these fragments were derived? O RKNSSFWAALLIGVVQTEED O LLIGVVQTSFWAARKNSEED O SSFWAALLQTEEDIGVVRKN O IGVVRKNSSFWAALLQTEEDarrow_forwardThe enzyme dihydrofolate oxidase has 3 adjacent asparagines residues (codon for asparagines is ACC): explain how site directed mutagenesis could be used to increase the thermal stability of the proteinarrow_forwardProvide the sequences of the template and coding strands of a DNA double helix that was used to produce this RNA: 5'-AUUACGGUCUAU. Be sure to label the 5' and 3' ends.arrow_forward
- Please choose the right answers.arrow_forwardYou are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA encoding this peptide is included in the sequence shown below. 5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3' 3'-GCACTGCCGAGCACCTTCGATCAGTAG-5' This sequence does not contain any BamHI restriction enzyme sites. The target sequence for the BamHI restriction nuclease is GGATCC. Your goal is to create a BamHI site on this plasmid by manipulating the DNA sequence, without changing the coding sequence of the protein. How would you do this, ie what would the new sequence be?arrow_forwardThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.arrow_forward
- For the DNA sequence shown, indicate the products of its cleavage with the following restriction endonucleases (AKA restriction enzymes):5′-ACAGCTGATTCGAATTCACGTT-3′3′-TGTCGACTAAGCTTAAGTGCAA-5′a) EcoRI (the recognition sequence and cleavage site is G↓AATTC);b) AluI (the recognition sequence and cleavage site is AG↓CT).arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardRifamycins have been used for the treatment of many diseases, including HIV-related Tuberculosis. Explain how Rifamycins inhibit the activities of bacterial DNA dependent RNA polymerase.arrow_forward
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'arrow_forwardAilee is interested to determine the nucleotide sequence of her bacterial heat shock gene. Hence, DNA sequencing needs to be performed for this analysis. One of the earliest methods invented is known as Sanger sequencing. Explain in detail the mechanism of this sequencing technique with the aid of a simple diagram.arrow_forwardWhile there is a T nucleotide in one position in one of the double chains, if there is a G nucleotide opposite this nucleotide in the complementary chain; Does this pose a problem? If you think it will cause a problem, explain what kind of problem it may create. What repair systems might work to fix this problem? Briefly describe the operation of these systems.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning