Microbiology: An Introduction (13th Edition)
13th Edition
ISBN: 9780134605180
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case, Derek Weber, Warner Bair
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 1MCQ
Match the following terms to the definitions in questions 1and 2.
- a. conjugation
- b. transcription
- c. transduction
- d. transformation
- e. translation
1. Transfer of DNA from a donor to a recipient cell by a bacteriophage.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
91) The NDV virus
a. The mesogenic ND is less virulent than lentogenic than NDV
b. The antigenomic copy is the template for both making genome and making subgenus
c. The RNA polymerase is only made in the first round of translation
d. The Fusion protein is the virulent protein
Please consider the figure attached
i. The ordinate (i.e., 'y-axis') represents values for the C or G nucleotide base proportion in sequences (or, in this case, genomes).ii. Influenza viruses that infected birds or moved from birds to humans without spreading are characterised by higher A + U content relative to influenza viruses that infected humans for long time periods.iii. Influenza viruses adapted to human hosts are characterised by lower G + C content relative to influenza viruses that infected birds or moved from birds to humans without spreading.
iv. Human and swine influenza A H1N1 strains evolved from a birdlike G + C state to a humanlike G + C state since 1918.
v. Data such as those depicted in the figure have been interpreted as evidence that the 1918 influenza virus strain originated from a bird influenza virus population.
Question 1 options:
A)
Statement ii conveys accurate information.
B)
Statements ii,…
Define the following terms: a. anti nucleoside b. HGPRT c. Lesch–Nyhan syndrome d. purine salvage e. gout
Chapter 8 Solutions
Microbiology: An Introduction (13th Edition)
Ch. 8 - Briefly describe the components of DNA, and...Ch. 8 - DRAW IT Identify and mark each of the following on...Ch. 8 - Match the following examples of mutagens. Column A...Ch. 8 - The following is a code for a strand of DNA. a....Ch. 8 - Prob. 5RCh. 8 - Identify when (before transcription, after...Ch. 8 - Which sequence is the best target for damage by UV...Ch. 8 - You are provided with cultures with the following...Ch. 8 - Why are mutation and recombination important in...Ch. 8 - NAME IT Normally a commensal in the human...
Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Feedback inhibition differs from repression...Ch. 8 - Bacteria can acquire antibiotic resistance by all...Ch. 8 - Suppose you inoculate three flasks of minimal...Ch. 8 - Plasmids differ from transposons in that plasmids...Ch. 8 - Mechanism by which the presence of glucose...Ch. 8 - The mechanism by which lactose controls the lac...Ch. 8 - Two offspring cells are most likely to inherit...Ch. 8 - Which of the following is not a method of...Ch. 8 - Nucleoside analogs and ionizing radiation are used...Ch. 8 - Replication of the E. coli chromosome takes 40 to...Ch. 8 - Pseudomonas has a plasmid containing the mer...Ch. 8 - Ciprofloxacin, erythromycin, and acyclovir are...Ch. 8 - HIV, the virus that causes AIDS, was isolated from...Ch. 8 - Human herpesvirus-8 (HHV-8) is common in parts of...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (5th Edition)
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
Seeley's Anatomy & Physiology
Identify each of the following reproductive barriers as prezygotic or postzygotic. a. One lilac species lives o...
Campbell Essential Biology with Physiology (5th Edition)
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues (8th Edition)
Physiology a. deals with the processes or functions of living things. b. is the scientific discipline that inve...
SEELEY'S ANATOMY+PHYSIOLOGY
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Define the following terms: a. proteasome b. ubiquitination c. ubiquitin-conjugating system d. ubiquitin ligase e. autophagyarrow_forward____________ proliferate by cutting and pasting the original copy to another part of the genome, while ____________ proliferate by reverse transcribing an mRNA copy of the original and inserting that into another part of the genome. Group of answer choices 1. Transposons; short tandem repeats 2. Retrotransposons; transposons 3. Retroviruses; transposable elements 4. Transposons; retrotransposonsarrow_forwardPLEASE ANSWER THE QUESTIONS 1. Why is it important to have knowledge of the correct method of translation? 2. Give situations in which it is necessary to use knowledge of translation.arrow_forward
- I read that vinyl chloride exposure is associated with an increased risk of a rare form of liver cancer (hepatic angiosarcoma), as well as brain and lung cancers, lymphoma, and leukemia. But my question is what gene(s) are being mutated by this type of taxic gas?arrow_forwardDefine the following terms:a. satellite DNAb. transpositionc. transposond. retrotransposone. endogenous retrovirusarrow_forwardWrite two paragraphs answering the following question briefly. How can transposons contribute to specific human diseases?. Please give it quicklyarrow_forward
- 69) in the first round of translation in Sheeppoxviruses the products are a. the proteins go back to the nucleus b. are composed of structural and non-structural proteins. c. this round of translation happened before the DNA genome replication d. among these products are the cellular RNA polymerase.arrow_forwardThe following sequence contains the first couple codons from the Moderna vaccine mRNA. Below it are versions of the same sequence, but each of these contain a mutation. Match these mutated sequences with the correct mutation type a b C d Original sequence AUG UUC GUG UUC CUG GUG CUG CUG CCC CUG GTG AGC AGC CAG UGC GUG AAC CUG AUG UUC GUG UUC CUG GUG CUG CUG CCC CUG GTG AGC AGC UAG UGC GUG AAC CUG AUG UUC GUG UCC CUG GUG CUG CUG CCC CUG GTG AGC AGC CAG UGC GUG AAC CUG AUG UUC GUG UUC CUG GUG CUG CUG CCA CUG GTG AGC AGC CAG UGC GUG AAC CUG AUG UUC GUG UUC CUG GUG CUG CUG CCC CUG GTG AGC AGC CAG UGC AGU GAA CCU 1. Synonymous 2. Nonsense 3. Non synonymous 4, Frameshiftarrow_forwardMatching type Choices are in the picture 1. Puromycin 2. Amanitin 3. Tetracycline 4. Rifampicin 5. Diphtheria Toxinarrow_forward
- Match each enzyme name in the left column with the correct descriptive phrase in the right column. a. Topoisomerase II b. DNA ligase c. DNA polymerase y d. Reverse transcriptase i. Catalyzes most nucleotide incorporations in bacterial DNA replication ii. Cleaves RNA in a DNA-RNA hybrid molecule e. DNA polymerase I f. DNA polymerase II iii. Uses a tRNA primer in synthesis of retroviral DNA iv. Acts through an adenylylated DNA inter- mediate v. Catalyzes formation of a double-strand DNA break vi. Catalyzes mitochondrial DNA replicationarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardCreate a cloning approach that will allow the expression of the SARS-CoV 2 nucleoprotein (NP) in human embryonic kidney (HEK-293) in order to examine protein function using Plasmid cloning Vector. In your strategy address the following; 2.1 Select a method for transfecting HEK-293 cells . Motivate your response and describe the principles of this strategy step by step.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license