Bundle: Biology: The Unity and Diversity of Life, Loose-leaf Version, 14th + LMS Integrated for MindTap Biology, 2 terms (12 months) Printed Access Card
14th Edition
ISBN: 9781305775480
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 11SQ
The phrase "5 prime to 3 prime" refers to the ______.
- a. timing of
DNA replication - b. directionality of DNA synthesis
- c. number of phosphate groups
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
DNA replication is described as semi-conservative because _____.
A. one leading strand and one lagging strand are produced in DNA replication
B. all new DNA strands are synthesized continuously
C. one new DNA strand is synthesized discontinuously
D. DNA replication can never produce DNA molecules which consist of both original DNA stands
E. one DNA strand is the template while the complementary strand is not
Arrange the following events of DNA replication in the proper order.
A. DnaA binds DNA
B. DNA polymerase binds to a free 3’ – OH
C. Topoisomerases act
D. Ori “melts/denatures”
a. Pfu Polymerase
b.dNTPs
c.Buffer
Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each.
1. unwinds DNA
2. synthesizes new DNA strands
3. enzymatically catalyzes Quikchange
4. nucleotide source for new DNA strands
5. Energy source for reaction(s)
6. Repairs errors in base pair matching
7. Maintains pH and salt levels
8. Creates polymer chains
Chapter 8 Solutions
Bundle: Biology: The Unity and Diversity of Life, Loose-leaf Version, 14th + LMS Integrated for MindTap Biology, 2 terms (12 months) Printed Access Card
Ch. 8 - Which is not a nucleotide base in DNA? a. adenine...Ch. 8 - What are the base-pairing rules for DNA? a. A-G,...Ch. 8 - Variation in _____ is the basis of variation in...Ch. 8 - One species' DNA differs from others in its...Ch. 8 - Prob. 5SQCh. 8 - Prob. 6SQCh. 8 - Prob. 7SQCh. 8 - When DNA replication begins, ______. a. the two...Ch. 8 - DNA replication requires _______. a. DNA...Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...
Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...Ch. 8 - Energy that drives the attachment of a nucleotide...Ch. 8 - The phrase "5 prime to 3 prime" refers to the...Ch. 8 - After DNA replication, a eukaryotic chromosome...Ch. 8 - Prob. 13SQCh. 8 - Prob. 14SQCh. 8 - Prob. 15SQCh. 8 - Prob. 1CTCh. 8 - Woolly mammoths have been extinct for about 4,000...Ch. 8 - Xeroderma pigmentosum is an inherited disorder...
Additional Science Textbook Solutions
Find more solutions based on key concepts
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
Some species of bacteria that live at the surface of sediment on the bottom of lakes are capable of using eithe...
Biology: Life on Earth with Physiology (11th Edition)
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
Nursing Student with Neuropathic Pain
Tamara Costa broke her right tibia and has undergone two separate surger...
Human Anatomy & Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In DNA replication, a primer is _____. a. what the original DNA strands are called b. a molecule that provides the energy for nucleotide attachments c. a regulatory protein that turns on the gene that starts DNA replication d. an enzyme that breaks the hydrogen bonds between base pairs e. a short piece of nucleic acid that serves as an attachment point for DNA polymerasearrow_forwardIn order for DNA molecules to undergo recombination, ____. a. their strands must separate as in replication b. they must be from the same species c. one of the two DNA strands must be degraded d. they must be cut and spliced at specific nucleotide sequences e. they must first be transcribedarrow_forwardwhen a cell to divide, its DNA must be replicated (copied). a.List the most important participating components and their functions in replication b.why is it important that the replication goes right and that relatively few mutations occur during the replication? c.Will the offspring of the individual who received a mutation inherit the mutationarrow_forward
- Indicate whether each of the following statementsrelating to aspects of DNA replication is true or false.a. The lagging strand grows in the same direction as thereplication fork moves.b. Growth of the leading strand involves the productionof Okazaki fragments.c. Lagging strands always involve “daughter” DNAsegments, and leading strands always involve“parent” DNA segments.d. The enzyme DNA ligase effects the unwinding of aDNA double helix.arrow_forwardThe phrase 5to3 refers to the _________ . a. timing of DNA replication b. directionality of DNA synthesis c. number of phosphate groupsarrow_forwardTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forward
- Just prior to DNA replication the cytosine in the sequence GTTCATTG is deaminated and it is not repaired before the DNA is replicated. Which of the following is the point mutation you expect in this sequence after the segment has undergone 2 rounds of DNA replication? a. GTTUATTG O b. GTTTATTG C. GTTGATTG d. GGTAATTG e. GTTAATTGarrow_forwardMatch the enzymes provided from (1-4) in the list of choices with their matching function (A-D) during DNA replication. A. Disrupts hydrogen bonds between DNA bases B. Can only add nucleotides to an existing 3 OH end C. Can't add nucleotides to a chain, but can make covalent bonds D. Actually a specialized form of RNA polymerase select 1. DNA polymerase select 2. Primase select 3. Ligase select v 4. Helicasearrow_forwardThe initial mechanism for repairing nucleotide errors in DNA is ________. a. mismatch repair b. DNA polymerase proofreading c. nucleotide excision repair d. thymine dimersarrow_forward
- Enzyme function is critically important for the proper replication of DNA. Predict the consequence of a loss of function for each of the following enzymes. a. DNA gyrase b. DNA polymerase III c. DNA ligase d. DNA polymerase Iarrow_forwardDetermine whether each statement isTRUE or FALSE.a. In eukaryotic chromosomes, DNA replication begins at a single point in the chromosome and proceeds in two directions.b. The bonds between the sugars and phosphates are broken during DNA replication.c. The elongation of the leading strand during DNA synthesis progresses away from the replication fork.d. Each DNA molecule resulting from replication has one original strand and one new strand.e. The difference in how the leading and lagging strands of DNA molecules are synthesized is due to DNA polymerase adding new nucleotides only to the 3’ end of a growing strand, and the strands are anti-parallel.arrow_forwardOkazaki fragments are ________. A. short RNA primers needed for initiation of polymerization B. fragments of DNA polymerase I that lack 5' → 3' exonuclease activity C. short stretches of DNA formed on the lagging strand D. the smallest subunits of DNA polymerase IIIarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license