
(a)
Interpretation:
The
Concept Introduction:
Gas law provides the mathematical terms and the relationships between the amount, pressure, temperature, and volume of a gas. According to gas law the units for above four terms can be given as follows,
- The unit for amount of a gas is generally represented in terms of moles of gas percent.
- The units for volume of a gas is generally represented in terms of liter and milliliter.
- The unit for temperature of a gas is generally represented in terms of Kelvin scale.
- The unit for pressure of a gas is generally represented in terms of torr.
(b)
Interpretation:
The gas law variable the given measurement 6.7mL has to be identified.
Concept Introduction:
Gas law provides the mathematical terms and the relationships between the amount, pressure, temperature, and volume of a gas. According to gas law the units for above four terms can be given as follows,
- The unit for amount of a gas is generally represented in terms of moles of gas percent.
- The units for volume of a gas is generally represented in terms of liter and milliliter.
- The unit for temperature of a gas is generally represented in terms of Kelvin scale.
- The unit for pressure of a gas is generally represented in terms of torr.
(c)
Interpretation:
The gas law variable the given measurement 673 torr has to be identified.
Concept Introduction:
Gas law provides the mathematical terms and the relationships between the amount, pressure, temperature, and volume of a gas. According to gas law the units for above four terms can be given as follows,
- The unit for amount of a gas is generally represented in terms of moles of gas percent.
- The units for volume of a gas is generally represented in terms of liter and milliliter.
- The unit for temperature of a gas is generally represented in terms of Kelvin scale.
- The unit for pressure of a gas is generally represented in terms of torr.
(d)
Interpretation:
The gas law variable the given measurement 0.23 mole has to be identified.
Concept Introduction:
Gas law provides the mathematical terms and the relationships between the amount, pressure, temperature, and volume of a gas. According to gas law the units for above four terms can be given as follows,
- The unit for amount of a gas is generally represented in terms of moles of gas percent.
- The units for volume of a gas is generally represented in terms of liter and milliliter.
- The unit for temperature of a gas is generally represented in terms of Kelvin scale.
- The unit for pressure of a gas is generally represented in terms of torr.

Trending nowThis is a popular solution!

Chapter 7 Solutions
Study Guide with Selected Solutions for Stoker's General, Organic, and Biological Chemistry, 7th
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengagePrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
