
More than one choice may apply.
Which of the following is an example of integration by the nervous system?
a. The feel of a cold breeze
b. Shivering and goose bumps in response to cold
c. Perceiving the sound of rain
d. The decision to go back for an umbrella

Introduction:
Integration by nervous system is a process in which the sensory input is processed and interpreted by the nervous system. On the basis of this interpretation, the decision of what must be done at each moment is taken.
Answer to Problem 1MC
Correct answer:
An example of integration via the nervous system is the decision to go back for an umbrella.
Justification for the correct answer:
Option (d) is given that the decision to go back for an umbrella is an example of integration via the nervous system. In this example, the decision is made by the nervous system by processing and interpreting the input. Thus, it is an example of integration via the nervous system. Hence, option (d) is correct.
Explanation of Solution
Explanation for incorrect answers:
Option (a) is given that the feel of a cold breeze is an example of integration via the nervous system. In this example, no decision is made by the nervous system by the processing and interpretation of the input. So, it is an incorrect option.
Option (b) is given that shivering as well as goosebumps in response to cold are an example of integration by the nervous system. In this example also, no decision is made via the nervous system. So, it is an incorrect option.
Option (c) is given that perceiving the sound of rain is an example of integration via the nervous system. In the given example, the nervous system does not make any decision. So, it is an incorrect option.
Hence, options (a), (b), and (c) are incorrect.
In integration via the nervous system, the nervous system processes the input and then interprets it to decide about the action that must be taken.
Want to see more full solutions like this?
Chapter 7 Solutions
Essentials of Human Anatomy & Physiology (12th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning


