
What are the three main parts of the axial skeleton?

To review:
The three main parts of the axial skeleton.
Introduction:
The central axis of the body is known as axial skeleton, which includes bones of the head and trunk of a vertebrate. It contains 80 bones and consists of skull, hyoid bone, vertebral column, auditory ausicles, ribs and sternum (chest cavity).
Explanation of Solution
The axial skeleton is controlled from 80 bones segregated into three major regions:
The skull: It is the most complex bony structure formed by cranial and facial bones, 22 in all. The cranial bones, or cranium enclose and protects brain and furnish attachment sites for head and neck muscles.
Vertebral column: Vertebral column is a series of 33 bones called vertebrae separated by invertebral discs.
Thoracic cage: Elements of the thoracic cage include the thoracic vertebrae posteriorly, the ribs laterally, and the sternum and costal cartilages anteriorly. Bony thorax forms a protective cage around the important organs of the thoracic cavity (lungs, heart, and great blood vessels).
This part of the skeleton are:
(1) it forms the longitudinal axis of the body,
(2) supports the head, neck, and trunk,
(3) protects the brain, spinal cord, and the organs in the thorax.
Therefore, it is concluded that three main parts of the axial skeleton are: skull, vertebral column, and thoracic cage.
Want to see more full solutions like this?
Chapter 7 Solutions
Anatomy & Physiology
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning


