
On What basis is the skeleton grouped into the axial and appendicular divisions?

To review:
The basis for the division of skeleton into axial and appendicular divisions.
Introduction:
The skeletal system contains different types of bones, which form the framework of the body. Bones protect the internal organs and help in the movement of body parts. Two hundred and six bones are found in the adult human body; the size and the shape of the bones differ greatly and each type has a specific function. The skeleton is divided into two main groups namely axial as well as an appendicular skeleton.
Explanation of Solution
Bones present in the longitudinal axis are grouped as an axial skeleton, while the appendicular skeleton is composed of the bones, which form girdles that connect the limbs to the axial skeleton, upper limbs, and lower limbs. The axial skeleton contains 80 bones, which include major structures like a hyoid bone, skull, vertebral column, as well as thorax. The appendicular skeleton contains 126 bones, which include major structures like a pectoral girdle, pelvic girdle, lower limbs, and upper limbs.
The axial skeleton protects and supports the organs in the ventral and dorsal cavities. It also creates the surface, on which the muscles could attach. The function of appendicular skeleton is to connect the limbs to the axial skeleton.
Thus, the skeleton is divided on the basis of the group of bones, which are present in the longitudinal axis and the bones, which form the appendages or extremities and girdles that joins limbs with the axial skeleton.
Want to see more full solutions like this?
Chapter 7 Solutions
Principles of Anatomy and Physiology
Additional Science Textbook Solutions
Organic Chemistry
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
Organic Chemistry (8th Edition)
Cosmic Perspective Fundamentals
Microbiology: An Introduction
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage



