Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 19P
The Ames test uses the reversion rate (His- to His+) to test compounds for mutagenicity.
| a. | Is it possible that a known mutagen, like proflavin, would be unable to revert a particular His- mutant used in the Ames test? How do you think that the Ames test is designed to deal with this issue? |
| b. | Can you think of a way to use forward mutation (His+ to His-) to test a compound for mutagenicity? (Hint: Consider using the replica plating technique in Fig. 7.6.) |
| c. | Given that the rate of forward mutation is so much higher than the rate of reversion, why does the Ames test use the reversion rate to test for mutagenicity? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How would you modify the Ames test to evaluate physical mutagens?Would it be necessary to add the rat liver extract? Explain why or why not.
Mutagenesis is a technique in which genetic information of an organism is altered in a stable
manner resulting in a mutation. It may occur spontaneously in nature of as a result of
exposure to mutagens. It can also be achieved experimentally using optimized laboratory
procedures.
(i)
(ii)
What is site directed mutagenesis (SDM)?
Explain how SDM can assist in the integration of a His-tag at the end of your gene of
interest.
Although a large number of mutagenic chemicals are known,none is known that induces mutations in only a single gene(gene-specific mutagenesis). From what you know aboutmutagens, explain why it is unlikely that a gene-specificchemical mutagen will be found. How then is site-specificmutagenesis accomplished?
Chapter 7 Solutions
Genetics: From Genes to Genomes
Ch. 7 - The following is a list of mutational changes. For...Ch. 7 - What explanations can account for the following...Ch. 7 - The DNA sequence of one strand of a gene from...Ch. 7 - Among mammals, measurements of the rate of...Ch. 7 - Over a period of several years, a large hospital...Ch. 7 - Suppose you wanted to study genes controlling the...Ch. 7 - In a genetics lab, Kim and Maria infected a sample...Ch. 7 - The results of the fluctuation test Fig. 7.5 were...Ch. 7 - The following pedigree shows the inheritance of a...Ch. 7 - Autism is a neurological disorder thought to be...
Ch. 7 - Like the yellow Labrador retrievers featured in...Ch. 7 - Remember that Balancer chromosomes prevent the...Ch. 7 - Figure 7.14 shows examples of base substitutions...Ch. 7 - Figure 7.14a shows the mutagen 5-bromouracil 5-BU,...Ch. 7 - So-called two-way mutagens can induce both a...Ch. 7 - In 1967, J. B. Jenkins treated wild-type male...Ch. 7 - When a particular mutagen identified by the Ames...Ch. 7 - Prob. 18PCh. 7 - The Ames test uses the reversion rate His- to His...Ch. 7 - The mutant FMR-1 allele that causes fragile X...Ch. 7 - The physicist Stephen Hawking, famous for his...Ch. 7 - Aflatoxin B1 is a highly mutagenic and...Ch. 7 - In human DNA, 70 of cytosine residues that are...Ch. 7 - Bromodeoxyuridine BrdU is a synthetic nucleoside...Ch. 7 - Albinism in animals is caused by recessive...Ch. 7 - a. In Figure 7.22b, what can you say about the...Ch. 7 - Imagine that you caught a female albino mouse in...Ch. 7 - Plant breeders studying genes influencing leaf...Ch. 7 - In humans, albinism is normally inherited in an...Ch. 7 - a. Seymour Benzers fine structure analysis of the...Ch. 7 - a. You have a test tube containing 5 ml of a...Ch. 7 - Prob. 32PCh. 7 - The rosy ry gene of Drosophila encodes an enzyme...Ch. 7 - Nine rII- mutants of bacteriophage T4 were used in...Ch. 7 - In a haploid yeast strain, eight recessive...Ch. 7 - In Problem 24, you learned that Bloom syndrome is...Ch. 7 - The pathway for arginine biosynthesis in...Ch. 7 - In corn snakes, the wild-type color is brown. One...Ch. 7 - In a certain species of flowering plants with a...Ch. 7 - The intermediates A, B, C, D, E, and F all occur...Ch. 7 - In each of the following cross schemes, two...Ch. 7 - Prob. 42PCh. 7 - The following complementing E. coli mutants were...Ch. 7 - In 1952, an article in the British Medical Journal...Ch. 7 - Mutations in an autosomal gene in humans cause a...Ch. 7 - Antibodies were made that recognize six proteins...Ch. 7 - Prob. 47PCh. 7 - Prob. 48PCh. 7 - In addition to the predominant adult hemoglobin,...Ch. 7 - Most mammals, including New World primates such as...Ch. 7 - Humans are normally trichromats; we have three...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can someone tell me why the answer is that the spill contained transition inducing mutagens?arrow_forwardIn the Ames test shown in Figure 16-17, what is the reason for adding the liver extract to each sample?arrow_forwardI have complete the table that required. Indicate which mutations were success why some were not from the size about. indicate at what stage any of the mutagenesis failed.arrow_forward
- You are working with a newly discovered mutagen, andyou wish to determine the base change that it introduces into DNA. Thus far, you have determined that themutagen chemically alters a single base in such a waythat its base-pairing properties are altered permanently.To determine the specificity of the alteration, you examine the amino acid changes that take place after mutagenesis. A sample of what you find is shown here:Original: Gln–His–Ile–Glu–LysMutant: Gln–His–Met–Glu–LysOriginal: Ala–Val–Asn–ArgMutant: Ala–Val–Ser–ArgOriginal: Arg–Ser–LeuMutant: Arg–Ser–Leu–Trp–Lys–Thr–PheWhat is the base-change specificity of the mutagen?arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGC TGAGGCCACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAG AATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAG GCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence Nar I GG/CGCC Dde I c/TNAG…arrow_forwardAfter performing analysis of whole genome sequencing from a candidate that grew on SC-H in the initial screen, you are unable to identify a causative mutation. Which of the following options is a likely explanation for why this mutant passed the initial screen? Select all that apply. A. The mutation is a truncation mutation and Illumina sequencing only provides information for missense mutations. B. One of the missense mutations you analyzed is actually causative, but the factor has not been previously linked to transcription. C. The causative mutation lies in a sequence coverage gap. D. The mutation is in a hypothetical protein and uncategorized genes cannot be sequenced by Illumina technology.arrow_forward
- After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?arrow_forwardA chemist synthesizes four new chemical compounds in the laboratory and names them PFI1, PFI2, PFI3, and PFI4. He gives the PFI compounds to a geneticist friend and asks her to determine their mutagenic potential. The geneticist finds that all four are highly mutagenic. She also tests the capacity of mutations produced by the PFI compounds to be reversed by other known mutagens and obtains the following results. What conclusions can you make about the nature of the mutations produced by these compounds? Reversed by Mutations produced by 2- Aminopurine Nitrous acid Hydroxylamine Acridine orange PFI1 Yes Yes Some No PFI2 No No No No PFI3 Yes Yes No No PFI4 No No No Yesarrow_forwardA chemist synthesizes four new chemical compounds in the laboratory and names them PFI1, PFI2, PFI3, and PFI4. He gives the PFI compounds to a geneticist friend and asks her to determine their mutagenic potential. The geneticist finds that all four are highly mutagenic. She also tests the capacity of mutations produced by the PFI compounds to be reversed by other known mutagens and obtains the following results. What conclusions can you make about the nature of the mutations produced by these compounds? Reversed by Mutations, Nitrous, Aminopurine acid Acridine orange 2- produced by Hydroxylamine PFI1 Yes Yes Some No PFI2 No No No No PFI3 Yes Yes No No PFI4 No No No Yesarrow_forward
- You are interested in studying resistance to heavy metals and have selected the yeast Saccharomyces cerevisea to conduct your studies. You have recovered a deletion mutant that does not tolerate high concentrations of zinc (grows poorly in zinc containing media ) and have designated the mutant pgz-1 (for poor growth in zinc ). (a) What is the advantage to the type of mutant used in this work? What class of mutagen was likely use to generate pgz-1? ( b) Do you expect the PGZ gene to be expressed in your mutant? Explain.arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T→A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGCTGAGGCC ACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAGAATCCCCCACTCCAC ACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence www wwwtw ww Nar I GG/CGCC…arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T->A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTG СTGAGGCCACTCCTGGTCACCATGACAАССАCAGGCCCTCTТСAGTATCACAGTAAGCCCTGGCAGG AGAATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAG CAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Bestriction enzyme Recognition sequence Nari GG/CGCC Ddel C/TOAG Hae II DGCGC/n Hpal cc/GG Alul AG/CT Smal ccc/GGG Mbol /GATC Mae II IGTDAC Bsp 1286 I GNGCn/c Hind II A/AGCTT ECOR I G/AATTC D: any Ducleotide 1:…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY