The amino acid sequence of the product formed by the DNA molecule with nucleotide base sequence TACGGGGGAGGGGGAGGGGGA . Concept introduction: The unit of genetic code, which has three nucleotides that code for amino acids, is called codon. The mRNA (messenger ribonucleic acid) got attached to the ribosomal complex in the cytoplasm. The transfer RNA conveys amino acids to the ribosomal complex where the pairing of an anticodon of tRNA (transfer ribonucleic acid) takes place with a complementary codon of the messenger RNA. Again, new amino acid is carried by tRNA, which again binds to the complementary codon of mRNA. In this way, amino acids get linked to each other, forming the long chain of the polypeptides.

Question

Want to see the full answer?

Answer 1

Question

Chapter 7, Problem 15CT

Summary Introduction

To determine:

The amino acid sequence of the product formed by the DNA molecule with nucleotide base sequence TACGGGGGAGGGGGAGGGGGA.

Concept introduction:

The unit of genetic code, which has three nucleotides that code for amino acids, is called codon. The mRNA (messenger ribonucleic acid) got attached to the ribosomal complex in the cytoplasm. The transfer RNA conveys amino acids to the ribosomal complex where the pairing of an anticodon of tRNA (transfer ribonucleic acid) takes place with a complementary codon of the messenger RNA.

Again, new amino acid is carried by tRNA, which again binds to the complementary codon of mRNA. In this way, amino acids get linked to each other, forming the long chain of the polypeptides.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Amino Acid Coclow TABle 3' Gly Phe Leu (G) (F) (L) 3- Val (V) Arg (R) Ser (S) Ala (A) Lys (K) CAG G Glu Asp (E) (D) Ser (S) CCCAGUCAGUCAGUCAG 0204 C U A G C Asn (N) G 4 A AGU C GU (5) AC C UGA A G5 C CUGACUGACUGACUGAC Thr (T) Met (M) lle £€ (1) U 4 G Tyr Σε (Y) U Cys (C) C A G Trp (W) 3' U C A Leu בוט His Pro (P) ££ (H) Gin (Q) Arg 흐름 (R) (L) Start Stop 8. Transcription and Translation Practice: (Video 10-1 and 10-2) A. Below is the sense strand of a DNA gene. Using the sense strand, create the antisense DNA strand and label the 5' and 3' ends. B. Use the antisense strand that you create in part A as a template to create the mRNA transcript of the gene and label the 5' and 3' ends. C. Translate the mRNA you produced in part B into the polypeptide sequence making sure to follow all the rules of translation. 5'-AGCATGACTAATAGTTGTTGAGCTGTC-3' (sense strand) 4

What is the structure and function of Eukaryotic cells, including their organelles? How are Eukaryotic cells different than Prokaryotic cells, in terms of evolution which form of the cell might have came first? How do Eukaryotic cells become malignant (cancerous)?

What are the roles of DNA and proteins inside of the cell? What are the building blocks or molecular components of the DNA and proteins? How are proteins produced within the cell? What connection is there between DNA, proteins, and the cell cycle? What is the relationship between DNA, proteins, and Cancer?