Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 7, Problem 13AQP

a.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

a.

Expert Solution

Explanation of Solution

If pattern of baldness is considered as sex-influenced trait, then the genes responsible for baldness must be present on autosomal chromosomes. Thus, the pattern of baldness would independently assort from genetic marker on X chromosomes.

b.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness, if the pattern of baldness is X-linked recessive.

b.

Expert Solution

Explanation of Solution

If the pattern of baldness is X-linked recessive trait, then the genes of baldness will be present on X chromosomes only. If the genes of baldness and genetic markers are present in close proximity on X chromosome, then they will not assort independently. If they lie far apart, then they will be assorted easily.

Conclusion

Independent assortment between genetic marker on the X chromosomes and pattern of blandness depends upon weather the pattern of baldness gene is sex-linked or X linked gene.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 7, Problem 13AQP

a.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

a.

Expert Solution

Explanation of Solution

If pattern of baldness is considered as sex-influenced trait, then the genes responsible for baldness must be present on autosomal chromosomes. Thus, the pattern of baldness would independently assort from genetic marker on X chromosomes.

b.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness, if the pattern of baldness is X-linked recessive.

b.

Expert Solution

Explanation of Solution

If the pattern of baldness is X-linked recessive trait, then the genes of baldness will be present on X chromosomes only. If the genes of baldness and genetic markers are present in close proximity on X chromosome, then they will not assort independently. If they lie far apart, then they will be assorted easily.

Conclusion

Independent assortment between genetic marker on the X chromosomes and pattern of blandness depends upon weather the pattern of baldness gene is sex-linked or X linked gene.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 7, Problem 13AQP

a.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

a.

Expert Solution

Explanation of Solution

If pattern of baldness is considered as sex-influenced trait, then the genes responsible for baldness must be present on autosomal chromosomes. Thus, the pattern of baldness would independently assort from genetic marker on X chromosomes.

b.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness, if the pattern of baldness is X-linked recessive.

b.

Expert Solution

Explanation of Solution

If the pattern of baldness is X-linked recessive trait, then the genes of baldness will be present on X chromosomes only. If the genes of baldness and genetic markers are present in close proximity on X chromosome, then they will not assort independently. If they lie far apart, then they will be assorted easily.

Conclusion

Independent assortment between genetic marker on the X chromosomes and pattern of blandness depends upon weather the pattern of baldness gene is sex-linked or X linked gene.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 7, Problem 13AQP

a.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

a.

Expert Solution

Explanation of Solution

If pattern of baldness is considered as sex-influenced trait, then the genes responsible for baldness must be present on autosomal chromosomes. Thus, the pattern of baldness would independently assort from genetic marker on X chromosomes.

b.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness, if the pattern of baldness is X-linked recessive.

b.

Expert Solution

Explanation of Solution

If the pattern of baldness is X-linked recessive trait, then the genes of baldness will be present on X chromosomes only. If the genes of baldness and genetic markers are present in close proximity on X chromosome, then they will not assort independently. If they lie far apart, then they will be assorted easily.

Conclusion

Independent assortment between genetic marker on the X chromosomes and pattern of blandness depends upon weather the pattern of baldness gene is sex-linked or X linked gene.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 7, Problem 13AQP

a.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

a.

Expert Solution

Explanation of Solution

If pattern of baldness is considered as sex-influenced trait, then the genes responsible for baldness must be present on autosomal chromosomes. Thus, the pattern of baldness would independently assort from genetic marker on X chromosomes.

b.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness, if the pattern of baldness is X-linked recessive.

b.

Expert Solution

Explanation of Solution

If the pattern of baldness is X-linked recessive trait, then the genes of baldness will be present on X chromosomes only. If the genes of baldness and genetic markers are present in close proximity on X chromosome, then they will not assort independently. If they lie far apart, then they will be assorted easily.

Conclusion

Independent assortment between genetic marker on the X chromosomes and pattern of blandness depends upon weather the pattern of baldness gene is sex-linked or X linked gene.

Answer 6

Chapter 7, Problem 13AQP

a.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

a.

Expert Solution

Explanation of Solution

If pattern of baldness is considered as sex-influenced trait, then the genes responsible for baldness must be present on autosomal chromosomes. Thus, the pattern of baldness would independently assort from genetic marker on X chromosomes.

Answer 7

Chapter 7, Problem 13AQP

a.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

Answer 8

a.

Expert Solution

Explanation of Solution

If pattern of baldness is considered as sex-influenced trait, then the genes responsible for baldness must be present on autosomal chromosomes. Thus, the pattern of baldness would independently assort from genetic marker on X chromosomes.

Answer 9

a.

Expert Solution

Answer 10

a.

Expert Solution

Answer 11

Expert Solution

Answer 12

b.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness, if the pattern of baldness is X-linked recessive.

b.

Expert Solution

Explanation of Solution

If the pattern of baldness is X-linked recessive trait, then the genes of baldness will be present on X chromosomes only. If the genes of baldness and genetic markers are present in close proximity on X chromosome, then they will not assort independently. If they lie far apart, then they will be assorted easily.

Conclusion

Independent assortment between genetic marker on the X chromosomes and pattern of blandness depends upon weather the pattern of baldness gene is sex-linked or X linked gene.

Answer 13

b.

Summary Introduction

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness, if the pattern of baldness is X-linked recessive.

Answer 14

b.

Expert Solution

Explanation of Solution

If the pattern of baldness is X-linked recessive trait, then the genes of baldness will be present on X chromosomes only. If the genes of baldness and genetic markers are present in close proximity on X chromosome, then they will not assort independently. If they lie far apart, then they will be assorted easily.

Answer 15

b.

Expert Solution

Answer 16

b.

Expert Solution

Answer 17

Expert Solution

Answer 18

Conclusion

Independent assortment between genetic marker on the X chromosomes and pattern of blandness depends upon weather the pattern of baldness gene is sex-linked or X linked gene.

Answer 19

Ch. 7.1 - Prob. 1COQ Ch. 7.1 - Prob. 1TPSQ Ch. 7.2 - Prob. 1CC Ch. 7.2 - Prob. 2CC Ch. 7.2 - Prob. 3CC Ch. 7.2 - Prob. 2COQ Ch. 7.2 - Prob. 3COQ Ch. 7.2 - Prob. 4COQ Ch. 7.2 - Prob. 5COQ Ch. 7.2 - Prob. 6COQ

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

To determine: Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

Explanation of Solution

To determine: Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness, if the pattern of baldness is X-linked recessive.

Explanation of Solution

Want to see more full solutions like this?

Chapter 7 Solutions

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness if the pattern of baldness is sex influenced

To determine:

Whether the pattern of baldness will show independent assortment between genetic marker on the X chromosomes and pattern of blandness, if the pattern of baldness is X-linked recessive.