SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
11th Edition
ISBN: 9781264802463
Author: VanPutte
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6.6, Problem 28AYP
Summary Introduction
To write:
The effects of estrogen and testosterone in bone growth and how these effects account for the average height difference observed in men and women.
Introduction:
The bone is a type of connective tissue. The bone cells make the bone matrix and become trapped in it. The cells also break down the old matrix so that the new matrix can take the place. Bone matrix composition is responsible for the characteristics of bone. Bones increase only in size through appositional development.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 6 Solutions
SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
Ch. 6.1 - Name the four components of the skeletal system.Ch. 6.1 - Describe the five major functions of the skeletal...Ch. 6.2 - What are the three types of cartilage? Which type...Ch. 6.2 - Describe the structure of hyaline cartilage. Name...Ch. 6.2 - Differentiate between oppositional and...Ch. 6.3 - Name the components of bone matrix, and explain...Ch. 6.3 - Differentiate among the characteristics and...Ch. 6.3 - Describe the formation of new bone by appositional...Ch. 6.3 - What cells give rise to osteochondral progenitor...Ch. 6.3 - How is the organization of collagen fibers...
Ch. 6.3 - Describe the structure of spongy bone. What are...Ch. 6.3 - Describe the structure of compact bone. What is an...Ch. 6.3 - Trace the pathway nutrients must follow from blood...Ch. 6.4 - List the four basic shapes of bones, and give an...Ch. 6.4 - Sketch and lable the parts of a typical long bone.Ch. 6.4 - Where are the periosteum and endosteum located,...Ch. 6.4 - What are red and yellow bone marrows? Where are...Ch. 6.4 - Compare the structure of a long bone with those of...Ch. 6.5 - Describe the formation of spongy and compact bone...Ch. 6.5 - For the process of endochondral ossification,...Ch. 6.5 - When do primary and secondary Ossification centers...Ch. 6.5 - What bones, or parts of bones, are formed from...Ch. 6.6 - Name and describe the events occurring in the four...Ch. 6.6 - Explain the process of growth at the articular...Ch. 6.6 - Describe how new osteons are produced as a bone...Ch. 6.6 - Prob. 26AYPCh. 6.6 - Prob. 27AYPCh. 6.6 - Prob. 28AYPCh. 6.7 - Why is it important for bone remodeling to occur?Ch. 6.7 - What is a basic multicellular unit (BMU)? Explain...Ch. 6.7 - Prob. 31AYPCh. 6.8 - What are the four steps of bone repair?Ch. 6.8 - Prob. 33AYPCh. 6.8 - Distinguish between the location and composition...Ch. 6.8 - Prob. 35AYPCh. 6.9 - Prob. 36AYPCh. 6.9 - Prob. 37AYPCh. 6.9 - Prob. 38AYPCh. 6.9 - Prob. 39AYPCh. 6.10 - What effect does aging hove on the quality and...Ch. 6.10 - Prob. 41AYPCh. 6 - Prob. 1RACCh. 6 - Chondrocytes are mature cartilage cells within the...Ch. 6 - Which of these statements concerning cartilage is...Ch. 6 - Prob. 4RACCh. 6 - Prob. 5RACCh. 6 - Prob. 6RACCh. 6 - Prob. 7RACCh. 6 - Prob. 8RACCh. 6 - Prob. 9RACCh. 6 - Prob. 10RACCh. 6 - Prob. 11RACCh. 6 - The periosteum a. is an epithelial tissue...Ch. 6 - Prob. 13RACCh. 6 - Prob. 14RACCh. 6 - Prob. 15RACCh. 6 - Prob. 16RACCh. 6 - Prob. 17RACCh. 6 - During growth in length of a long bone, cartilage...Ch. 6 - Prob. 19RACCh. 6 - Prob. 20RACCh. 6 - Prob. 21RACCh. 6 - Bone remodelling can occur When woven bone is...Ch. 6 - Given these processes: (1) cartilage ossification...Ch. 6 - Which of these processes during bone repair...Ch. 6 - Prob. 25RACCh. 6 - Prob. 1CTCh. 6 - Explain why running helps prevent osteoporosis in...Ch. 6 - Prob. 3CTCh. 6 - Prob. 4CTCh. 6 - Prob. 5CTCh. 6 - Prob. 6CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Nutrition Through The Life CycleHealth & NutritionISBN:9781337919333Author:Brown, Judith E.Publisher:Cengage Learning,Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Nutrition Through The Life Cycle
Health & Nutrition
ISBN:9781337919333
Author:Brown, Judith E.
Publisher:Cengage Learning,

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY