Concept explainers
Introduction: Every species in an environment plays a crucial role in maintaining the balance of the environment and affects the existence of other dependent species. Some species are at the verge of nonexistence and they are called endangered species.

Answer to Problem 1TY
Correct answer: Endangered species is a species that is in danger of becoming extinct throughout all or a significant portion of its range. This statement best describes an endangered species. Hence, the correct answer is option d.
Explanation of Solution
Reason for correct answer:
Endangered species are the species that are at the verge of extinction from the whole world. If the species are not looked after or properly cared, then these species can seize to exist. This is not exactly limited to a particular portion of the species instead it is applicable to the complete range.
Option d. is given as “a species that is in danger of becoming extinct throughout all or a significant portion of its range”.
Endangered species are the species that are at the verge of extinction and the existence of these species is threatened to a significant or throughout all portion of its range. Hence, the correct answer is option d.
Reason for incorrect answer:
Option a. is given as “a species that is likely to become extinct in a portion of its range”.
Endangered species are likely to become extinct through all of its range and the threat of extinction is not limited to a small range. Hence, option a. is incorrect.
Option b. is given as “a species that has disappeared in a particular community but is present in other natural environments”.
A species is called endangered species if it has almost disappeared from the natural environment and not just from few communities. Hence, option b. is incorrect.
Option c. is given as “a species that is extinct”.
The endangered species are not completely extinct and can be saved if proper preventive measures are undertaken. Hence, option c. is incorrect.
Option e. is given as, “Both b and d are true of endangered species”.
Option d “a species that is in danger of becoming extinct throughout all or a significant portion of its range” is the correct explanation of endangered species. However, option b “species that have disappeared in a particular community but is present in other natural environments” does not explain endangered species. Hence, option e. is incorrect.
Hence, the options a., b., c. and e. are incorrect.
The given statement “endangered species is a species that is in danger of becoming extinct throughout all or a significant portion of its range” best describes an endangered species.
Want to see more full solutions like this?
Chapter 60 Solutions
BROOKER BIO 3-HOLE PUNCH W/CONNECT BUND
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning




