MICROBIOLOGY W/ACCESS
4th Edition
ISBN: 9781266808685
Author: Cowan
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6, Problem 5MCQ
Summary Introduction
Introduction:
Prophage is the inactive stage of the bacteriophage. The prophage forms when bacteriophage does not replicate immediately after the penetration into the host bacterium, instead it convert in self in an inactive form called prophage and replicate during the normal cell division of the bacterial cell.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 6 Solutions
MICROBIOLOGY W/ACCESS
Ch. 6.1 - Describe the significance of viruses being...Ch. 6.2 - Summarize arguments on both sides of the debate...Ch. 6.2 - Identify effective terms to describe the behavior...Ch. 6.3 - Prob. 4AYPCh. 6.3 - Describe the function and structure(s) of viral...Ch. 6.3 - Distinguish between enveloped and naked viruses.Ch. 6.3 - Prob. 7AYPCh. 6.3 - Compare and contrast the composition of a viral...Ch. 6.3 - Diagram the possible nucleic acid configurations...Ch. 6.4 - Develop two arguments against assigning species...
Ch. 6.4 - Demonstrate how family and genus names in viruses...Ch. 6.5 - Prob. 2CFCh. 6.5 - Diagram the six-step life cycle of animal viruses.Ch. 6.5 - Define the term cytopathic effect and provide one...Ch. 6.5 - Provide examples of persistent and transforming...Ch. 6.5 - Provide a thorough description of lysogenic and...Ch. 6.6 - List the three principal purposes for cultivating...Ch. 6.6 - Describe three ways in which viruses are...Ch. 6.7 - Prob. 18AYPCh. 6.8 - Analyze the relative importance of viruses in...Ch. 6.8 - Prob. 20AYPCh. 6 - Prob. 1CFCh. 6 - A virus is a tiny infectious a. cell. b. living...Ch. 6 - Viruses are known to infect a. plants. b....Ch. 6 - The nucleic acid of a virus is a. DNA only. b. RNA...Ch. 6 - The general steps in a viral multiplication cycle...Ch. 6 - Prob. 5MCQCh. 6 - In general, RNA viruses multiply in the cell ____,...Ch. 6 - Viruses cannot be cultivated in/on a. tissue...Ch. 6 - Clear patches in cell cultures that indicate sites...Ch. 6 - Label the parts of this virus. Identify the...Ch. 6 - Circle the viral infections from this list:...Ch. 6 - In lysogeny, viral DNA is inserted into the host...Ch. 6 - A viral capsid is composed of subunits called...Ch. 6 - The envelope of an animal virus is derived from...Ch. 6 - The nucleic acid of animal viruses enters the cell...Ch. 6 - Viruses that persist in the (host) cell and cause...Ch. 6 - Provide evidence in support of or refuting the...Ch. 6 - Summarize the unique properties of viruses and...Ch. 6 - Prob. 3CTQCh. 6 - Prob. 4CTQCh. 6 - Prob. 5CTQCh. 6 - Prob. 6CTQCh. 6 - Prob. 7CTQCh. 6 - Prob. 8CTQCh. 6 - Prob. 9CTQCh. 6 - Prob. 10CTQCh. 6 - Prob. 1CCCh. 6 - Prob. 2CCCh. 6 - Prob. 3CCCh. 6 - Prob. 4CCCh. 6 - Prob. 1VCCh. 6 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning