
Concept explainers
A cat eats a bird, which ate a caterpillar that chewed on a weed. Which of these organisms are autotrophs? Which ones are heterotrophs?

To identify:
The autotrophic organism from the scenario in which a cat eat a bird, which ate a caterpillar that chewed on a weed.
Introduction:
Different organisms take nutrition in different ways. The organisms are divided into autotrophs and heterotrophs on the basis of nutrition. Autotrophs make their own food and heterotrophs depend on other organisms to take up the nutrition.
Explanation of Solution
Autotrophs take up raw material from the surrounding and use it to synthesize their food on their own. In autotrophs, photosynthesis is a metabolic pathway that uses carbon dioxide and water from surrounding and converts it into sugars and oxygen molecules.
In the given scenario, the weed is an autotroph because it can synthesize its own food by photosynthesis.

To determine:
The heterotrophic organism from the scenario in which a cat eat a bird, which ate a caterpillar that chewed on a weed.
Introduction:
Different organisms take nutrition in different ways. The organisms are divided into autotrophs and heterotrophs on the basis of nutrition. Autotrophs make their own food and heterotrophs depend on other organisms to take up the nutrition.
Explanation of Solution
Heterotrophs are animals that are dependent on other organisms to take organic carbon. They utilize organic carbon to convert it into energy. Photosynthesis is not carried out by these animals because they derive nutrition of others.
In the given scenario, the cat is dependent on a bird for nutrition and that bird takes nutrition by eating a caterpillar. Caterpillar chewed on a weed so it takes its nutrition from an autotroph. All these animals are dependent on other organisms to fulfill the need for nutrition.
Hence, in this scenario, the cat, the bird, and the caterpillar are the example of heterotrophs.
Want to see more full solutions like this?
Chapter 6 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax





