
A.
To determine: The mother’s genotype in terms of the sickle cell gene and whether the mother is homozygous or heterozygous.
Introduction: The disorders which are caused by a single mutant or defective gene are known as a single-gene disorder. The mutant gene may be present on an autosome or X chromosome. The defective gene may affect only one member of an autosomal gene pair or both pairs.
A.

Explanation of Solution
The sickle cell anemia is a genetic disorder in which the shape or structure of the red blood cells is changed due to two abnormal genes of the β-globin gene, which is responsible for making hemoglobin. The shape of the blood cells is changed to a sickle-like shape. The genotype of a mother with sickle cell anemia will be HbSHbS( Hb is for hemoglobin and S is for defective sickle cell gene). The mother is homozygous, which means that she will have the same alleles (HbSHbS).
B.
To determine: The probability of their child having the disease or being a carrier of the sickle cell trait.
Introduction: The single gene defect follows the pattern of a mendelian pattern of inheritance and is known as Mendelian disorders. Sickle cell anemia is a blood-related disorder in which there is a decrease in healthy red blood cells.
B.

Explanation of Solution
The sickle cell anemia is an inherited disorder that affects the hemoglobin molecule present in the red blood cell, responsible for carrying the oxygen throughout the body. The people with sickle cell anemia have an abnormal hemoglobin molecule S, which affects the shape of the red blood cell and convert it to a sickle shape.
The mother has sickle cell anemia with genotype HbSHbS, whereas the father may be normal (HbAHbA) or a carrier (HbAHbA) of the trait. If the father is the carrier of the trait, then the chances of the child getting the disorder are 50%, and if the father is normal, then the next generation will be 100% carrier of the disorder.
Want to see more full solutions like this?
Chapter 6 Solutions
Essentials of Pathophysiology: Concepts of Altered States
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





