
Concept explainers
While vacuuming, you show off by telling a friend that you are using electrical energy to create a lower-entropy state. She replies that you are taking advantage of increasing solar entropy. Explain this conversation.

To explain:
The conversation between two friends. One of them claims that electrical energy is used to create lower entropy state while other replied that taking the advantage of increasing solar entropy.
Introduction:
The entropy indicates the amount of disorganization or randomness of molecules in a closed system. The entropy is low in organized molecules (for example glucose) and the entropy is high in disorganized molecules (for example carbon dioxide and water).
Explanation of Solution
The second law of thermodynamics states that the energy can change from one form to another with the loss of some usable energy. According to the second law of thermodynamics, the amount of energy released is not used for any mechanical work.
Vacuum cleaner uses electrical energy to create lower entropy state, which means that most of the energy is being utilized for mechanical work with least loss of entropy. This situation determines the lower entropy, where the maximum amount of electrical energy is utilized for mechanical work.
Solar entropy is that form of energy which is not used for mechanical work. So, the use of vacuum cleaner utilizes electrical energy which releases some amount of solar energy in the form of heat, which results in the increase of entropy.
Vacuum cleaner utilized electrical energy for mechanical work with least loss of energy. This results in the decrease of entropy. While solar entropy causes the release of energy which results in an increase of entropy.
Want to see more full solutions like this?
Chapter 6 Solutions
Biology: Life on Earth with Physiology (11th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning




