C++ Programming: From Problem Analysis to Program Design
8th Edition
ISBN: 9781337102087
Author: D. S. Malik
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Question
Chapter 6, Problem 11SA
Program Plan Intro
Program Plan:
- Define the function isWhitespace, which takes a single character as input and returns a Boolean value indicating whether the character is a whitespace character or not.
- Within the isWhitespace function, use a series of conditional statements to check if the character is equal to any of the whitespace characters: space (' '), tab ('\t'), newline ('\n'), carriage return ('\r'), form feed ('\f'), or vertical tab ('\v').
- If the character is equal to any of the whitespace characters, return true; otherwise, return false.
- Define the main function.
- Within the main function, declare several character variables, and assign them different characters including whitespace and non-whitespace characters.
- Pass each of these character variables to the isWhitespace function to test whether they are whitespace characters or not.
- Print the results of each test using std::cout.
Program Description:
To define a function that can be used to determine whether a given character is a whitespace character or not.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Under what circumstances can you successfully return a pointer from a function?
3A in Python language please:
Programming Language : R programming (R Studio)
A twin prime is a prime that has a prime gap of two. Sometimes the term twin prime isused for a pair of twin primes. For example, the five twin prime pairs are (3, 5), (5, 7),(11, 13), (17, 19) and (29, 31). Write a function that returns the number of all twin primepairs between 1 and a given number n.
Chapter 6 Solutions
C++ Programming: From Problem Analysis to Program Design
Ch. 6 - Mark the following statements as true or false:
a....Ch. 6 - Determine the value of each of the following...Ch. 6 - Determine the value of each of the following...Ch. 6 - Consider the following function definition. (4, 6)...Ch. 6 - Consider the following statements:
Which of the...Ch. 6 - Prob. 8SACh. 6 - Prob. 9SACh. 6 - Why do you need to include function prototypes in...Ch. 6 - Prob. 11SACh. 6 - Consider the following function: (4)...
Ch. 6 - Prob. 15SACh. 6 - What is the output of the following program? (4)
Ch. 6 - Write the definition of a function that takes as...Ch. 6 - Prob. 18SACh. 6 - How would you use a return statement in a void...Ch. 6 - Prob. 20SACh. 6 - Prob. 21SACh. 6 - What is the output of the following program?...Ch. 6 - Write the definition of a void function that takes...Ch. 6 - Write the definition of a void function that takes...Ch. 6 - Prob. 8PECh. 6 - The following formula gives the distance between...Ch. 6 - Write a program that takes as input five numbers...Ch. 6 - When you borrow money to buy a house, a car, or...Ch. 6 - Consider the definition of the function main:...Ch. 6 - The statements in the following program are not in...Ch. 6 - Write a program that outputs inflation rates for...Ch. 6 - Write a program to convert the time from 24-hour...Ch. 6 - Jason opened a coffee shop at the beach and sells...
Knowledge Booster
Similar questions
- integer) Write a function that computes the sum of the digits in an integer. Use the following function header:def sumDigits(n):For example, sumDigits(234) returns 9 (Hint: Use the % operator to extract digits, and the // operator to remove the extracted digit. For instance, toextract 4 from 234, use 234 % 10 To remove 4 from 234, use 234 // 10 (=23) Use a loop to repeatedly extract and remove the digits until all the digits are extracted.) Write a test program that prompts the user to enter an integer and displays the sum of all its digits.arrow_forward3- It is not possible to change the value of the pointer. (True or False). 4- If the following lines of code have errors, correct them; otherwise, write "no errors." for (int i=2; i<5; i++) { int s=1*2; } cout << s; 5- A function cannot be called from inside another function. (True or False). 6- How to make a function return multiple values? 7- Every class member is by default. (public, private, not public nor private) 8- Create an instance of the following class and call its methods. class Exam{ int grade; public: void seta (int b) (grade=b; } int geta () {return grade; } 9- When the word const is put before the variable definition, what does that mean? 10- How to concatenate two strings in C++ language? C++arrow_forwardi just need the code please java C++arrow_forward
- Using “Def” keyword write a function that compares two arrays, if both are the same it will return true, else it will return false. (The function name will be AreArraysEqual) Not: Write some print functions to see the outputs inside each function. (Python programming language)arrow_forwardTrue/False 7. Python functions can never modify a parameterarrow_forwardWhen should you use an inline function?arrow_forward
- Computer Sciencearrow_forward*You need to have at least one user define function *Language: C programming Write a program to find whether a given number is a Palindrome number (number that is same when you read from forward or backward). You need to take a long integer number from user as input and verify whether it’s a number and positive or not. If the input is not valid (e.g., string or float) or positive, then notify the user and ask to input valid positive number again. If the number is valid then check whether it’s a palindrome number or not. [Hint: For splitting the digits from the given number, you need to use mod % and div / operators. E.g., 123/10 = 12 & 123%10 = 3] Input: Key in a number to check: -23 Output: The number -23 is not valid Key in a number to check: 123454321 The number 123454321 is a PALINDROME Do you want to continue (y/n)? y Key in a number to check: 456734 The number 456734 is NOT a PALINDROME Do you want to continue (y/n)? n Good bye!!arrow_forwardC++ Programming. Topic: Working with pointers and dynamic memory. Indicators. Working with dynamic memory. Dynamic arrays and their use as function parameters. Task : Describe a void function named Swap(x,y) that swaps the values stored in the variables x and (x is a real type parameter and is both input and output). Using this function , for the given variables of real type a, b, c, d, one should sequentially replace the values of the pairs (a, b), (c, d) and (b, c) and let a, b, c, d be new values .arrow_forward
- What are the benefits of using a function?arrow_forwardC++ True or falsearrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology PtrC++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning