
Biology (MindTap Course List)
10th Edition
ISBN: 9781285423586
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 56.4, Problem 1C
Summary Introduction
To define: Biogeography and what do biogeographers do.
Introduction: A biome is a large distinct ecological community of plants and animals living together in a particular climate. It is a level of organization between the landscape and biosphere. It is the largest geographical biotic unit and it not only composed the climax vegetation, but also includes associated successional communities, fauna, persistent subclimax communities, and soil.
Expert Solution & Answer

Trending nowThis is a popular solution!

Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 56 Solutions
Biology (MindTap Course List)
Ch. 56.1 - Define biome and briefly describe the nine major...Ch. 56.1 - Describe at least one human effect on each of the...Ch. 56.1 - What climate and soil factors produce the major...Ch. 56.1 - What representative organisms are found in each of...Ch. 56.1 - How does tundra compare to desert? How does...Ch. 56.2 - Explain the important environmental factors that...Ch. 56.2 - Prob. 4LOCh. 56.2 - Briefly describe the various freshwater,...Ch. 56.2 - Describe at least one human effect on each of the...Ch. 56.2 - Prob. 1C
Ch. 56.2 - Prob. 2CCh. 56.2 - How do you distinguish between freshwater wetlands...Ch. 56.2 - Prob. 4CCh. 56.2 - Which aquatic ecosystem is often compared to...Ch. 56.3 - Prob. 7LOCh. 56.3 - Prob. 1CCh. 56.4 - Prob. 8LOCh. 56.4 - Prob. 1CCh. 56.4 - Prob. 2CCh. 56 - The northernmost biome, known as __________,...Ch. 56 - Forests of the northeastern and middle Atlantic...Ch. 56 - The deepest, richest soil in the world occurs in...Ch. 56 - This biome, with its thicket of evergreen shrubs...Ch. 56 - This biome is a tropical grassland interspersed...Ch. 56 - This biome has the greatest species richness, (a)...Ch. 56 - Prob. 7TYUCh. 56 - Emergent vegetation grows in the __________ zone...Ch. 56 - The _______________ is open ocean from the...Ch. 56 - The transition zone where two ecosystems or biomes...Ch. 56 - Which biogeographic realm has been separated from...Ch. 56 - INTERPRET DATA Develop a hypothesis to explain why...Ch. 56 - INTERPRET DATA Examine Figure 56-1. What is the...Ch. 56 - INTERPRET DATA Examine Figure 56-24. How many of...Ch. 56 - PREDICT What would happen to the organisms in a...Ch. 56 - EVOLUTION LINK When a black-tailed prairie dog or...Ch. 56 - SCIENCE, TECHNOLOGY, AND SOCIETY Imagine that you...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Evidence for Evolution - Biogeography; Author: Viced Rhino;https://www.youtube.com/watch?v=304wIG6H11E;License: Standard YouTube License, CC-BY