Campbell Biology (10th Edition)
10th Edition
ISBN: 9780321775658
Author: Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 5.4, Problem 3CC
WHAT IF? Ø Where would you expect a polypeptide region rich in the amino acids valine, leucine, and isoleucine to be located in a folded polypeptide? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Remembering that the amino acid side chains projecting from each polypeptide backbone in a β sheet point alternately above and below the plane of the sheet, consider the following protein sequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg- Leu-Lys-Ile-Arg-Phe-Glu. Do you find anything remarkable about the arrangement of the amino acids in this sequence when incorporated into a β sheet? Can you make any predictions as to how the β sheet might be arranged in a protein?
Where would you expect a polypeptide region Ridge and the amino acid valine, leucine, and isoleucine to be located in a folded polypeptide? explain
(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a
stable model Holliday junction.
W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’
X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3'
Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3'
Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3'
I and 21
Chapter 5 Solutions
Campbell Biology (10th Edition)
Ch. 5.1 - What are the four main classes of large biological...Ch. 5.1 - How many molecules of water are needed to...Ch. 5.1 - WHAT IF? If you eat a piece of fish, what...Ch. 5.2 - Write the formula for a monosaccharide that has...Ch. 5.2 - Prob. 2CCCh. 5.2 - WHAT IF? After a cow is given antibiotics to...Ch. 5.3 - Compare the structure of a fat (triglyceride) with...Ch. 5.3 - Why are human sex hormones considered lipids?Ch. 5.3 - Prob. 3CCCh. 5.4 - What parts of a polypeptide participate in the...
Ch. 5.4 - Prob. 2CCCh. 5.4 - WHAT IF? Where would you expect a polypeptide...Ch. 5.5 - Prob. 1CCCh. 5.5 - DRAW IT In a DNA double helix, a region along one...Ch. 5.6 - How would sequencing the entire genome of an...Ch. 5.6 - Given the function of DNA, why would you expect...Ch. 5 - What is the fundamental basis for the differences...Ch. 5 - Compare the composition, structure, and function...Ch. 5 - Why are lipids not considered to be polymers or...Ch. 5 - Explain the basis for the great diversity of...Ch. 5 - What role does complementary base pairing play in...Ch. 5 - Prob. 5.6CRCh. 5 - Prob. 1TYUCh. 5 - The enzyme amylase can break glycosidic linkages...Ch. 5 - Prob. 3TYUCh. 5 - The structural level of a protein least affected...Ch. 5 - Enzymes that break down DNA catalyze the...Ch. 5 - The molecular formula for glucose is C6H12O6. What...Ch. 5 - Which of the following pairs of base sequences...Ch. 5 - Construct a table that organizes the following...Ch. 5 - Prob. 9TYUCh. 5 - EVOLUTION CONNECTION Comparisons of amino acid...Ch. 5 - SCIENTIFIC INQUIRY Suppose you are a research...Ch. 5 - WRITE ABOUT A THEME: ORGANIZATION Proteins, which...Ch. 5 - SYNTHESIZE YOUR KNOWLEDGE Given that the function...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Nursing Student with Neuropathic Pain
Tamara Costa broke her right tibia and has undergone two separate surger...
Human Anatomy & Physiology (11th Edition)
The term ‘spore’.
Biology Science Notebook
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction
WHAT IF? As a cell begins the process of dividing, its chromosomes become shorter, thicker, and individually vi...
Campbell Biology in Focus (2nd Edition)
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by doublestranded DNA? (b) What level is shown by tRNA? (c) What level is shown by mRNA?arrow_forwardSYNZIPS are a-helices that can be used in synthetic biology to create coiled-coil interactions between two different proteins. SYNZIP1 is around 47 amino acids in length. If each turn in an a-helix is 3.6 residues in length and each turn is 5.4 Å in length, how long is SYNZIP1? Keep in mind that 1 Å = 10 nm. Present your answer in nm.arrow_forwardThe figure shows an example of a thermal denaturation plot. The melting temperature (Tm) is the midpoint of the temperature range over which denaturation occurs. Percent unfolded 100 80 60 40 20 0 20 Tm 40 60 Temperature (°C) 80 100arrow_forward
- Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary)as defined for proteins.(a) What level is shown by double-stranded DNA?(b) What level is shown by tRNA?(c) What level is shown by mRNA?arrow_forwardConsider a short peptide that forms an alpha-helix within a larger protein structure. Suppose that one glutamate residue at some specific position in the helix were mutated to a leucine residue. The mutation could either make the helix more stable, or less stable. i) Describe two situations in which a Glu-to-Leu mutation could make the helix more stable. ii) Describe two situations in which the Glu-to-Leu mutation could make the helix less stable. Explain briefly the basis for the stabilizing and destabilizing effect in all cases.arrow_forwardThe diagram to the right illustrates the inter-actions of the amino acid side chains of two a-helical polypeptide strands in a coiled-coil, viewed end-on and projected along the helix axes from the N-terminal to the C-terminal end. Are the macrodipoles of the two a- helices oriented parallel or anti-parallel? For this projec- tion is the positive end of the macro-dipole in the sur- face of the paper or below the surface? f C b g e d a' a d' g b' f'arrow_forward
- Nonearrow_forwardA biotechnology company focused on peptide therapeutics is investigating the properties of several peptides for a variety of applications. Their sequences are given below: Pep A: NGSLGAAGRG Pep B: KKALLAHALH Pep C: LVQAIFPTPS a. What is the net charge of each sequence at pH 7 (to the nearest 0.1 charge unit)? b. Which peptide sequence would be most likely to be part of an intrinsically ordered domain in a protein? Explain. c. Which peptide would likely be best suited as part of a pH-sensitive drug carrier that is designed to change its charge between neutral pH and endosomal pH (which is between 5 and 6)? Explain. d. Which peptide sequence would be most likely to be buried in the interior of a protein? Explain.arrow_forward3) You are working on a protein with the following sequence in an area of interest. -Asp-Leu-Leu-Gln-Glu-Glu-Asp-Glu-Ser-Arg a. The current structure, solved at pH 7.4, of this segment has an alpha helix that is disrupted a er the Gln. Why might the alpha helix stop at this residue? b. This protein is involved in Lysosomes in vivo. The secondary structure of this region is expected to change into a complete alpha helix. Why might this change into a complete helix? ( Hint: Lysosomes are acidic!)arrow_forward
- Solve (a) , (b), (c), and (d). All is one problem.arrow_forward. Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold). Consider the cases shown schematically below for two variants of the same protein. In case #1 the disulfide forms between Cys residues that have been introduced near the protein N- and C-termini, and in case #2 the disulfide forms between Cys residues that have been introduced in the middle of the protein sequence. Which protein is likely to be more stable? (Note: Assume the disulfide bond is intact in both the unfolded and folded states). Explain your reasoning.arrow_forwardThe following are sequences from three different alpha helices found inhuman proteins: hBak(72-87): GQVGRQLAIIGDDINR hCB1(196-210): VTASFTASVGSLFLT hCB2(248-262): LVLAVLLICWFPVL Classify each of these three helices as either a) mostly hydrophobic, b)mostly hydrophilic, or c) amphipathic. Use the helical wheel to explainyour answers. Given the character of these helices, in which part of the protein wouldyou expect them to reside?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license