Biology (MindTap Course List)
10th Edition
ISBN: 9781285423586
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 52.2, Problem 3LO
Summary Introduction
To explain: The adaptive significance of habituation, imprinting, classical conditioning, operant conditioning, and cognition.
Introduction: A type of learning which helps an animal to ignore a repeated and irrelevant stimulus is called habituation. Imprinting refers to learning from previous experiences studied in certain birds and mammals. A link between normal body function and new stimulus comes under classical conditioning. The animal should earn a reward to avoid punishment in case of operant conditioning. The process of acquiring and utilizing knowledge is called as cognition.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is
equivalent to acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source.
NADH
FADH2
OP ATP
Show your work using dimensional analysis here:
SLP ATP
Total ATP
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Chapter 52 Solutions
Biology (MindTap Course List)
Ch. 52.1 - Prob. 1LOCh. 52.1 - Prob. 2LOCh. 52.1 - In what ways are the behaviors of Philanthus, the...Ch. 52.1 - Prob. 2CCh. 52.1 - Prob. 3CCh. 52.2 - Prob. 3LOCh. 52.2 - Prob. 1CCh. 52.2 - Prob. 2CCh. 52.3 - Prob. 4LOCh. 52.3 - Prob. 5LO
Ch. 52.3 - Prob. 1CCh. 52.3 - What is the difference between directional...Ch. 52.4 - Prob. 6LOCh. 52.4 - Prob. 1CCh. 52.4 - Prob. 2CCh. 52.5 - Prob. 7LOCh. 52.5 - Describe common modes of animal communication,...Ch. 52.5 - Prob. 9LOCh. 52.5 - Prob. 1CCh. 52.5 - Prob. 2CCh. 52.5 - Prob. 3CCh. 52.5 - Prob. 4CCh. 52.5 - Prob. 5CCh. 52.6 - Prob. 10LOCh. 52.6 - Prob. 1CCh. 52.6 - Prob. 2CCh. 52.6 - Prob. 3CCh. 52.6 - Prob. 4CCh. 52.7 - Prob. 11LOCh. 52.7 - Prob. 1CCh. 52.7 - Prob. 2CCh. 52.8 - Prob. 12LOCh. 52.8 - Prob. 1CCh. 52.8 - Prob. 2CCh. 52.8 - Prob. 3CCh. 52 - Prob. 1TYUCh. 52 - Prob. 2TYUCh. 52 - Prob. 3TYUCh. 52 - Prob. 4TYUCh. 52 - Prob. 5TYUCh. 52 - Chemical signals that convey information among...Ch. 52 - Prob. 7TYUCh. 52 - Sexual selection (a) occurs mainly among animals...Ch. 52 - Prob. 9TYUCh. 52 - Prob. 10TYUCh. 52 - Kin selection (a) increases inclusive fitness...Ch. 52 - Prob. 12TYUCh. 52 - Prob. 13TYUCh. 52 - INTERPRET DATA Look at the two graphs in Figure...Ch. 52 - Prob. 15TYUCh. 52 - How is the society of a social insect different...Ch. 52 - EVOLUTION LINK What might be the adaptive value of...Ch. 52 - SCIENCE, TECHNOLOGY, AND SOCIETY Consider how the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Awnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forward
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Issues and Ethics in the Helping Professions (Min...NursingISBN:9781337406291Author:Gerald Corey, Marianne Schneider Corey, Cindy CoreyPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Issues and Ethics in the Helping Professions (Min...
Nursing
ISBN:9781337406291
Author:Gerald Corey, Marianne Schneider Corey, Cindy Corey
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning