Deuterostomes are different from protostomes in the way that the first opening during development is for the development into the anus. A pore in the gastrula, which is formed first during the development of an organism, is called the blastopore. It is formed so that the embryo is able to interact and exchange materials with its surroundings.

Question

Want to see the full answer?

Answer 1

Question

Chapter 51, Problem 6TYU

Summary Introduction

Introduction: Deuterostomes are different from protostomes in the way that the first opening during development is for the development into the anus. A pore in the gastrula, which is formed first during the development of an organism, is called the blastopore. It is formed so that the embryo is able to interact and exchange materials with its surroundings.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 51, Problem 6TYU

Summary Introduction

Introduction: Deuterostomes are different from protostomes in the way that the first opening during development is for the development into the anus. A pore in the gastrula, which is formed first during the development of an organism, is called the blastopore. It is formed so that the embryo is able to interact and exchange materials with its surroundings.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 51, Problem 6TYU

Summary Introduction

Introduction: Deuterostomes are different from protostomes in the way that the first opening during development is for the development into the anus. A pore in the gastrula, which is formed first during the development of an organism, is called the blastopore. It is formed so that the embryo is able to interact and exchange materials with its surroundings.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 51, Problem 6TYU

Summary Introduction

Introduction: Deuterostomes are different from protostomes in the way that the first opening during development is for the development into the anus. A pore in the gastrula, which is formed first during the development of an organism, is called the blastopore. It is formed so that the embryo is able to interact and exchange materials with its surroundings.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 51, Problem 6TYU

Summary Introduction

Introduction: Deuterostomes are different from protostomes in the way that the first opening during development is for the development into the anus. A pore in the gastrula, which is formed first during the development of an organism, is called the blastopore. It is formed so that the embryo is able to interact and exchange materials with its surroundings.

Answer 6

Chapter 51, Problem 6TYU

Summary Introduction

Introduction: Deuterostomes are different from protostomes in the way that the first opening during development is for the development into the anus. A pore in the gastrula, which is formed first during the development of an organism, is called the blastopore. It is formed so that the embryo is able to interact and exchange materials with its surroundings.

Answer 7

Chapter 51, Problem 6TYU

Summary Introduction

Introduction: Deuterostomes are different from protostomes in the way that the first opening during development is for the development into the anus. A pore in the gastrula, which is formed first during the development of an organism, is called the blastopore. It is formed so that the embryo is able to interact and exchange materials with its surroundings.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 51.1 - Prob. 1LO Ch. 51.1 - Prob. 2LO Ch. 51.1 - Prob. 1C Ch. 51.1 - Prob. 2C Ch. 51.2 - Prob. 3LO Ch. 51.2 - Prob. 4LO Ch. 51.2 - How do the mechanisms of fertilization ensure...Ch. 51.2 - Prob. 2C Ch. 51.3 - Prob. 5LO Ch. 51.3 - Contrast early development, including cleavage, in...

Solution Summary: The author explains that the primitive groove in the embryo of birds is the functional equivalent of the blastopore.

Videos

Want to see the full answer?

Chapter 51 Solutions