All organisms behave and respond in different ways to various stimuli. This depicts their adaptive level and the success of their evolution. The behavior or cause of any organisms or an event can be explained in two ways on the basis of the mechanism (proximate) and on the basis of evolution (ultimate).

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 50, Problem 1TYK

Summary Introduction

Introduction:

All organisms behave and respond in different ways to various stimuli. This depicts their adaptive level and the success of their evolution. The behavior or cause of any organisms or an event can be explained in two ways on the basis of the mechanism (proximate) and on the basis of evolution (ultimate).

Expert Solution & Answer

Answer to Problem 1TYK

Correct answer:

The proximate explanations of behavior focus on genetic, neurological, and hormonal mechanisms of behavior.

Explanation of Solution

Justification for the correct answer:

Option (c) is given that the proximate theory relies on the genetic, neurological, and hormonal factors for the explanation of any behavior. This theory depends on the mechanisms that take place inside the body of the organism under study. Hence, option (c) is correct.

Justification for the incorrect answer:

Option (a) is given that displays and other types of behavior change or evolve over time. The ultimate theory depends on the evolutionary process for explaining the behavior and displays of an organism. The behavioral patterns are justified on the basis of the evolution of the organism of interest with time. So, it is an incorrect option.

Option (b) is given that proximate theory relies on the “adaptive significance” of a behavior. Any behavior can be explained on the basis of natural selection and adaptation, but does not involve any physiological mechanisms of the body. So, it is an incorrect option.

Option (d) is given that proximate theory relies on appropriate experimental methods when studying the behavior of an organism. Experiments are also performed for studying the behavior of an organism. This is a one-time explanation for the current behavior of the organism of interest. This does not state whether such characteristics were possessed by the ancestors of the organism of interest or not. So, it is an incorrect option.

Hence, options (a), (b), and (d) are incorrect.

Conclusion

The proximate explanations of the behavior of the organisms depend on the genetic, neurological, and hormonal levels. This theory focuses on the internal body mechanisms of the organisms to explain the kind of behavior they show.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Question

Chapter 50, Problem 1TYK

Summary Introduction

Introduction:

All organisms behave and respond in different ways to various stimuli. This depicts their adaptive level and the success of their evolution. The behavior or cause of any organisms or an event can be explained in two ways on the basis of the mechanism (proximate) and on the basis of evolution (ultimate).

Expert Solution & Answer

Answer to Problem 1TYK

Correct answer:

The proximate explanations of behavior focus on genetic, neurological, and hormonal mechanisms of behavior.

Explanation of Solution

Justification for the correct answer:

Option (c) is given that the proximate theory relies on the genetic, neurological, and hormonal factors for the explanation of any behavior. This theory depends on the mechanisms that take place inside the body of the organism under study. Hence, option (c) is correct.

Justification for the incorrect answer:

Option (a) is given that displays and other types of behavior change or evolve over time. The ultimate theory depends on the evolutionary process for explaining the behavior and displays of an organism. The behavioral patterns are justified on the basis of the evolution of the organism of interest with time. So, it is an incorrect option.

Option (b) is given that proximate theory relies on the “adaptive significance” of a behavior. Any behavior can be explained on the basis of natural selection and adaptation, but does not involve any physiological mechanisms of the body. So, it is an incorrect option.

Option (d) is given that proximate theory relies on appropriate experimental methods when studying the behavior of an organism. Experiments are also performed for studying the behavior of an organism. This is a one-time explanation for the current behavior of the organism of interest. This does not state whether such characteristics were possessed by the ancestors of the organism of interest or not. So, it is an incorrect option.

Hence, options (a), (b), and (d) are incorrect.

Conclusion

The proximate explanations of the behavior of the organisms depend on the genetic, neurological, and hormonal levels. This theory focuses on the internal body mechanisms of the organisms to explain the kind of behavior they show.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 50, Problem 1TYK

Summary Introduction

Introduction:

All organisms behave and respond in different ways to various stimuli. This depicts their adaptive level and the success of their evolution. The behavior or cause of any organisms or an event can be explained in two ways on the basis of the mechanism (proximate) and on the basis of evolution (ultimate).

Expert Solution & Answer

Answer to Problem 1TYK

Correct answer:

The proximate explanations of behavior focus on genetic, neurological, and hormonal mechanisms of behavior.

Explanation of Solution

Justification for the correct answer:

Option (c) is given that the proximate theory relies on the genetic, neurological, and hormonal factors for the explanation of any behavior. This theory depends on the mechanisms that take place inside the body of the organism under study. Hence, option (c) is correct.

Justification for the incorrect answer:

Option (a) is given that displays and other types of behavior change or evolve over time. The ultimate theory depends on the evolutionary process for explaining the behavior and displays of an organism. The behavioral patterns are justified on the basis of the evolution of the organism of interest with time. So, it is an incorrect option.

Option (b) is given that proximate theory relies on the “adaptive significance” of a behavior. Any behavior can be explained on the basis of natural selection and adaptation, but does not involve any physiological mechanisms of the body. So, it is an incorrect option.

Option (d) is given that proximate theory relies on appropriate experimental methods when studying the behavior of an organism. Experiments are also performed for studying the behavior of an organism. This is a one-time explanation for the current behavior of the organism of interest. This does not state whether such characteristics were possessed by the ancestors of the organism of interest or not. So, it is an incorrect option.

Hence, options (a), (b), and (d) are incorrect.

Conclusion

The proximate explanations of the behavior of the organisms depend on the genetic, neurological, and hormonal levels. This theory focuses on the internal body mechanisms of the organisms to explain the kind of behavior they show.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 50, Problem 1TYK

Summary Introduction

Introduction:

All organisms behave and respond in different ways to various stimuli. This depicts their adaptive level and the success of their evolution. The behavior or cause of any organisms or an event can be explained in two ways on the basis of the mechanism (proximate) and on the basis of evolution (ultimate).

Expert Solution & Answer

Answer to Problem 1TYK

Correct answer:

The proximate explanations of behavior focus on genetic, neurological, and hormonal mechanisms of behavior.

Explanation of Solution

Justification for the correct answer:

Option (c) is given that the proximate theory relies on the genetic, neurological, and hormonal factors for the explanation of any behavior. This theory depends on the mechanisms that take place inside the body of the organism under study. Hence, option (c) is correct.

Justification for the incorrect answer:

Option (a) is given that displays and other types of behavior change or evolve over time. The ultimate theory depends on the evolutionary process for explaining the behavior and displays of an organism. The behavioral patterns are justified on the basis of the evolution of the organism of interest with time. So, it is an incorrect option.

Option (b) is given that proximate theory relies on the “adaptive significance” of a behavior. Any behavior can be explained on the basis of natural selection and adaptation, but does not involve any physiological mechanisms of the body. So, it is an incorrect option.

Option (d) is given that proximate theory relies on appropriate experimental methods when studying the behavior of an organism. Experiments are also performed for studying the behavior of an organism. This is a one-time explanation for the current behavior of the organism of interest. This does not state whether such characteristics were possessed by the ancestors of the organism of interest or not. So, it is an incorrect option.

Hence, options (a), (b), and (d) are incorrect.

Conclusion

The proximate explanations of the behavior of the organisms depend on the genetic, neurological, and hormonal levels. This theory focuses on the internal body mechanisms of the organisms to explain the kind of behavior they show.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 50, Problem 1TYK

Summary Introduction

Introduction:

All organisms behave and respond in different ways to various stimuli. This depicts their adaptive level and the success of their evolution. The behavior or cause of any organisms or an event can be explained in two ways on the basis of the mechanism (proximate) and on the basis of evolution (ultimate).

Expert Solution & Answer

Answer to Problem 1TYK

Correct answer:

The proximate explanations of behavior focus on genetic, neurological, and hormonal mechanisms of behavior.

Explanation of Solution

Justification for the correct answer:

Option (c) is given that the proximate theory relies on the genetic, neurological, and hormonal factors for the explanation of any behavior. This theory depends on the mechanisms that take place inside the body of the organism under study. Hence, option (c) is correct.

Justification for the incorrect answer:

Option (a) is given that displays and other types of behavior change or evolve over time. The ultimate theory depends on the evolutionary process for explaining the behavior and displays of an organism. The behavioral patterns are justified on the basis of the evolution of the organism of interest with time. So, it is an incorrect option.

Option (b) is given that proximate theory relies on the “adaptive significance” of a behavior. Any behavior can be explained on the basis of natural selection and adaptation, but does not involve any physiological mechanisms of the body. So, it is an incorrect option.

Option (d) is given that proximate theory relies on appropriate experimental methods when studying the behavior of an organism. Experiments are also performed for studying the behavior of an organism. This is a one-time explanation for the current behavior of the organism of interest. This does not state whether such characteristics were possessed by the ancestors of the organism of interest or not. So, it is an incorrect option.

Hence, options (a), (b), and (d) are incorrect.

Conclusion

The proximate explanations of the behavior of the organisms depend on the genetic, neurological, and hormonal levels. This theory focuses on the internal body mechanisms of the organisms to explain the kind of behavior they show.

Answer 6

Chapter 50, Problem 1TYK

Summary Introduction

Introduction:

All organisms behave and respond in different ways to various stimuli. This depicts their adaptive level and the success of their evolution. The behavior or cause of any organisms or an event can be explained in two ways on the basis of the mechanism (proximate) and on the basis of evolution (ultimate).

Expert Solution & Answer

Answer to Problem 1TYK

Correct answer:

The proximate explanations of behavior focus on genetic, neurological, and hormonal mechanisms of behavior.

Explanation of Solution

Justification for the correct answer:

Option (c) is given that the proximate theory relies on the genetic, neurological, and hormonal factors for the explanation of any behavior. This theory depends on the mechanisms that take place inside the body of the organism under study. Hence, option (c) is correct.

Justification for the incorrect answer:

Option (a) is given that displays and other types of behavior change or evolve over time. The ultimate theory depends on the evolutionary process for explaining the behavior and displays of an organism. The behavioral patterns are justified on the basis of the evolution of the organism of interest with time. So, it is an incorrect option.

Option (b) is given that proximate theory relies on the “adaptive significance” of a behavior. Any behavior can be explained on the basis of natural selection and adaptation, but does not involve any physiological mechanisms of the body. So, it is an incorrect option.

Option (d) is given that proximate theory relies on appropriate experimental methods when studying the behavior of an organism. Experiments are also performed for studying the behavior of an organism. This is a one-time explanation for the current behavior of the organism of interest. This does not state whether such characteristics were possessed by the ancestors of the organism of interest or not. So, it is an incorrect option.

Hence, options (a), (b), and (d) are incorrect.

Conclusion

The proximate explanations of the behavior of the organisms depend on the genetic, neurological, and hormonal levels. This theory focuses on the internal body mechanisms of the organisms to explain the kind of behavior they show.

Answer 7

Chapter 50, Problem 1TYK

Summary Introduction

Introduction:

All organisms behave and respond in different ways to various stimuli. This depicts their adaptive level and the success of their evolution. The behavior or cause of any organisms or an event can be explained in two ways on the basis of the mechanism (proximate) and on the basis of evolution (ultimate).

Answer 8

Expert Solution & Answer

Answer to Problem 1TYK

Correct answer:

The proximate explanations of behavior focus on genetic, neurological, and hormonal mechanisms of behavior.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Explanation of Solution

Justification for the correct answer:

Option (c) is given that the proximate theory relies on the genetic, neurological, and hormonal factors for the explanation of any behavior. This theory depends on the mechanisms that take place inside the body of the organism under study. Hence, option (c) is correct.

Justification for the incorrect answer:

Option (a) is given that displays and other types of behavior change or evolve over time. The ultimate theory depends on the evolutionary process for explaining the behavior and displays of an organism. The behavioral patterns are justified on the basis of the evolution of the organism of interest with time. So, it is an incorrect option.

Option (b) is given that proximate theory relies on the “adaptive significance” of a behavior. Any behavior can be explained on the basis of natural selection and adaptation, but does not involve any physiological mechanisms of the body. So, it is an incorrect option.

Option (d) is given that proximate theory relies on appropriate experimental methods when studying the behavior of an organism. Experiments are also performed for studying the behavior of an organism. This is a one-time explanation for the current behavior of the organism of interest. This does not state whether such characteristics were possessed by the ancestors of the organism of interest or not. So, it is an incorrect option.

Hence, options (a), (b), and (d) are incorrect.

Answer 12

Conclusion

The proximate explanations of the behavior of the organisms depend on the genetic, neurological, and hormonal levels. This theory focuses on the internal body mechanisms of the organisms to explain the kind of behavior they show.

Answer 13

Ch. 50 - Prob. 1TYK Ch. 50 - Prob. 2TYK Ch. 50 - Prob. 5TYU Ch. 50 - Propose an evolutionary hypothesis to explain the...Ch. 50 - Prob. 8TYU Ch. 50 - 10. J. B. S. Haldane once remarked that he’d be...Ch. 50 - Prob. 11PIAT Ch. 50 - Researchers followed tagged blue whales to observe...Ch. 50 - Prob. 13PIAT Ch. 50 - Prob. 14PIAT

Concept explainers

Answer to Problem 1TYK

Explanation of Solution

Want to see more full solutions like this?

Chapter 50 Solutions