Videos
What is the meaning of the word roots epi-, sub: cutaneous, and derm?
To review:
The meaning of word roots epi-, sub-, cutaneous, and derm.
Introduction:
Words are generally comprised of two or more than two terms. The parts of a word that can be added with a prefix or suffix to form a new word are termed as word roots. The meaning of a word can be described by the meaning of the words that constitute it. Meaning of the word root is helpful in biology to understand the complex biological terms.
Explanation of Solution
Complex terms in biology are comprised of various basic words. The knowledge of the meaning of these words is helpful in determining the meaning as well as the definition of complex terms that are formed by them. The meaning of various word root terms is listed below:
1. Epi: The root meaning of “epi� is upon or over the skin. It is used in the word epidermis. The word root epi- in epidermis symbolizes above the skin.
2. Sub: The root meaning of “sub� is below or beneath. The word sub in sublingual refers to below the lingual/tongue.
3. Cutaneous: The root meaning of “cutaneous� is related to skin. The word root meaning of subcutaneous is below the skin.
4. Derm: The root meaning of “derm� is the skin. The word root meaning of “epiderm� is upon or above the skin.
Want to see more full solutions like this?
Chapter 5 Solutions
Human Anatomy
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning