MICROBIOLOGY W/ACCESS
4th Edition
ISBN: 9781266808685
Author: Cowan
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 13TF
Summary Introduction
Introduction:
The protists that cannot synthesize their own food, but acquire it from the organic content in the environment are heterotrophic protists. The protozoan comes under the heterotrophic protists. All protozoa are unicellular organisms.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 5 Solutions
MICROBIOLOGY W/ACCESS
Ch. 5.1 - Relate bacterial, archaeal, and eukaryotic cells...Ch. 5.1 - List the types of eukaryotic microorganisms and...Ch. 5.2 - Differentiate between cilia and flagella in...Ch. 5.2 - Prob. 4AYPCh. 5.2 - Prob. 5AYPCh. 5.2 - Prob. 6AYPCh. 5.3 - Describe the main structural components of a...Ch. 5.3 - Diagram how the nucleus, endoplasmic reticulum,...Ch. 5.3 - Explain the function of the mitochondrion.Ch. 5.3 - Prob. 10AYP
Ch. 5.3 - Prob. 11AYPCh. 5.3 - Prob. 12AYPCh. 5.4 - Prob. 13AYPCh. 5.4 - Differentiate among the terms heterotroph,...Ch. 5.4 - Prob. 15AYPCh. 5.4 - Prob. 16AYPCh. 5.4 - Prob. 17AYPCh. 5.5 - Prob. 2CFCh. 5.5 - Prob. 18AYPCh. 5.5 - Prob. 19AYPCh. 5.5 - Prob. 20AYPCh. 5.5 - Prob. 21AYPCh. 5.6 - Prob. 22AYPCh. 5.6 - Summarize the stages of a typical helminth life...Ch. 5 - Prob. 1CFCh. 5 - Both flagella and cilia are found primarily in a....Ch. 5 - Features of the nuclear envelope include a....Ch. 5 - The cell wall is found in which eukaryotes? a....Ch. 5 - Prob. 4MCQCh. 5 - Algae generally contain some type of a. spore. b....Ch. 5 - Almost all protozoa have a a. locomotor organelle....Ch. 5 - All mature sporozoa are a. parasitic. b....Ch. 5 - Parasitic helminths reproduce with a. spores. b....Ch. 5 - Mitochondria likely originated from a. archaea. b....Ch. 5 - Most helminth infections a. are localized to one...Ch. 5 - Prob. 11TFCh. 5 - Prob. 12TFCh. 5 - Prob. 13TFCh. 5 - Prob. 14TFCh. 5 - Prob. 15TFCh. 5 - Summarize the endosymbiotic theory and explain how...Ch. 5 - Prob. 2CTQCh. 5 - Compare and contrast the structure and function of...Ch. 5 - Write a paragraph illustrating the life of a...Ch. 5 - Prob. 5CTQCh. 5 - Prob. 6CTQCh. 5 - Prob. 7CTQCh. 5 - Prob. 8CTQCh. 5 - Prob. 9CTQCh. 5 - Prob. 10CTQCh. 5 - Prob. 1CCCh. 5 - Prob. 2CCCh. 5 - Prob. 3CCCh. 5 - Prob. 1VCCh. 5 - Prob. 2VCCh. 5 - Using the words that follow, please create a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
