
Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 49.1, Problem 3C
Summary Introduction
To explain: The way in which the body response when the concentration of calcium decreases below the homeostatic level.
Introduction: Endocrine cells or neurosecretory cells secrete hormones into the extracellular fluids that are signaling molecules. The secreted hormones reach the target cells through the bloodstream. Hormones bind only to specific cells based on the corresponding receptors and they act through chemical signals. Homeostasis is the regulation of the internal conditions of the body to maintain an optimum internal environment despite changing external conditions.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 49 Solutions
Biology (MindTap Course List)
Ch. 49.1 - Prob. 1LOCh. 49.1 - Prob. 2LOCh. 49.1 - Identify four main chemical groups to which...Ch. 49.1 - Prob. 1CCh. 49.1 - Prob. 2CCh. 49.1 - Prob. 3CCh. 49.1 - Prob. 4CCh. 49.2 - Compare four types of endocrine signaling.Ch. 49.2 - Prob. 1CCh. 49.2 - Prob. 2C
Ch. 49.2 - Prob. 3CCh. 49.3 - Compare the mechanism of action of small,...Ch. 49.3 - Prob. 1CCh. 49.3 - Prob. 2CCh. 49.3 - What is the mechanism of action of a hormone that...Ch. 49.4 - Prob. 6LOCh. 49.4 - Prob. 1CCh. 49.4 - Prob. 2CCh. 49.5 - Identify the classical vertebrate endocrine glands...Ch. 49.5 - Prob. 8LOCh. 49.5 - Describe the actions of the thyroid and...Ch. 49.5 - Contrast the actions of insulin and glucagon, and...Ch. 49.5 - Describe the actions and regulation of the adrenal...Ch. 49.5 - Prob. 1CCh. 49.5 - Prob. 2CCh. 49.5 - Prob. 3CCh. 49.5 - Prob. 4CCh. 49.5 - Prob. 5CCh. 49 - A cell secretes a product that diffuses through...Ch. 49 - Prob. 2TYUCh. 49 - Prob. 3TYUCh. 49 - Prob. 4TYUCh. 49 - Prob. 5TYUCh. 49 - Prob. 6TYUCh. 49 - Prob. 7TYUCh. 49 - Prob. 8TYUCh. 49 - Prob. 9TYUCh. 49 - Prob. 10TYUCh. 49 - Prob. 11TYUCh. 49 - Prob. 12TYUCh. 49 - Prob. 13TYUCh. 49 - Prob. 14TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
What is Homeostasis? | Physiology | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=quQr6X1Q58I;License: CC-BY