
Connect Access for Seeley's Anatomy and Physiology 180 Day Access for LIBERTY UNIVERSITY BIOL 213/215
11th Edition
ISBN: 9781259987304
Author: VanPutte
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4.8, Problem 54AYP
Summary Introduction
To write:
About the manifestation of inflammation and function of each of the manifestations of inflammation.
Introduction:
When the body encounters any harmful pathogen, irritation or tissue cell or damage, then in response against to these chnages inflammation takes place. In other words, the inflammation is a defense system of the body.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 4 Solutions
Connect Access for Seeley's Anatomy and Physiology 180 Day Access for LIBERTY UNIVERSITY BIOL 213/215
Ch. 4.1 - What components make up a tissue?Ch. 4.1 - Name the four primary tissue types and the...Ch. 4.1 - Define histology. Explain how the histology of...Ch. 4.2 - Name the three embryonic germ layers.Ch. 4.2 - Prob. 5AYPCh. 4.2 - List six characteristics common to most types of...Ch. 4.3 - List six characteristics common to most types of...Ch. 4.3 - What are the distinct cell surfaces found in...Ch. 4.3 - List and describe the major functions of...Ch. 4.3 - Describe simple, stratified, and pseudo stratified...
Ch. 4.3 - How do nonkeratinized stratified squarmous...Ch. 4.3 - Prob. 12AYPCh. 4.3 - List the types of epithelial tissue, giving the...Ch. 4.3 - Prob. 14AYPCh. 4.3 - Prob. 15AYPCh. 4.3 - What is the function of each of the following...Ch. 4.3 - Prob. 17AYPCh. 4.3 - Prob. 18AYPCh. 4.3 - What is the general function of gap junctions?Ch. 4.3 - Prob. 20AYPCh. 4.3 - Prob. 21AYPCh. 4.3 - Prob. 22AYPCh. 4.4 - What is the main characteristic that distinguishes...Ch. 4.4 - List the major functions of connective tissue, and...Ch. 4.4 - Explain th differences among blast. cyte, and...Ch. 4.4 - Prob. 26AYPCh. 4.4 - Contrast the structure and characteristics of...Ch. 4.4 - Describe the structure and functions of hyaluronic...Ch. 4.4 - Prob. 29AYPCh. 4.4 - List the two types of embryonic tissue. What does...Ch. 4.4 - What are the three classification of adult...Ch. 4.4 - Prob. 32AYPCh. 4.4 - Prob. 33AYPCh. 4.4 - Name the two types of adipose tissue, and give the...Ch. 4.4 - Prob. 35AYPCh. 4.4 - Prob. 36AYPCh. 4.4 - Name the two kinds of dense regular connective...Ch. 4.4 - Prob. 38AYPCh. 4.4 - Prob. 39AYPCh. 4.4 - Prob. 40AYPCh. 4.4 - What characteristic separates blood from other...Ch. 4.4 - Describe the function of hemopoietic tissue....Ch. 4.5 - Functionally, what is unique about muscle tissue?Ch. 4.5 - Compare the structure of skeletal, cardiac, and...Ch. 4.5 - Prob. 45AYPCh. 4.5 - Prob. 46AYPCh. 4.6 - What is the characteristic function of nervous...Ch. 4.6 - Prob. 48AYPCh. 4.6 - Differentiate among multipolar, bipolar, and...Ch. 4.6 - Prob. 50AYPCh. 4.7 - Prob. 51AYPCh. 4.7 - What are the functions of mucous serous and...Ch. 4.8 - What is the function of the inflammatory response?Ch. 4.8 - Prob. 54AYPCh. 4.9 - Define tissue repair. Differentiate between repair...Ch. 4.9 - Prob. 56AYPCh. 4.9 - Prob. 57AYPCh. 4.9 - What is granulation tissue? How does granulation...Ch. 4.10 - Prob. 59AYPCh. 4.10 - Prob. 60AYPCh. 4.10 - Prob. 61AYPCh. 4 - Given these characteristics: (I) capable of...Ch. 4 - Which of these embryonic germ layers gives rise to...Ch. 4 - Prob. 3RACCh. 4 - Stratified epithelium is usually found in areas of...Ch. 4 - Which of these characteristics do not describe...Ch. 4 - Prob. 6RACCh. 4 - Prob. 7RACCh. 4 - Pseudo stratified ciliated columnar epithelium can...Ch. 4 - Prob. 9RACCh. 4 - Prob. 10RACCh. 4 - A ________ gland has a duct that branches...Ch. 4 - Prob. 12RACCh. 4 - Mesenchymal cells a. form embryonic connective...Ch. 4 - Prob. 14RACCh. 4 - Prob. 15RACCh. 4 - Prob. 16RACCh. 4 - Which of these is not true of adipose tissue? a....Ch. 4 - Which of these types of connective tissue has the...Ch. 4 - Prob. 19RACCh. 4 - Prob. 20RACCh. 4 - Prob. 21RACCh. 4 - Which of these statements about nervous tissue is...Ch. 4 - The linings of the digestive, respiratory,...Ch. 4 - Prob. 24RACCh. 4 - Which of these types of cells is labile? a. neuron...Ch. 4 - Prob. 26RACCh. 4 - Given the observation that a tissue has more than...Ch. 4 - Prob. 2CTCh. 4 - Prob. 3CTCh. 4 - Prob. 4CTCh. 4 - Prob. 5CTCh. 4 - Prob. 6CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Immune System and Immune Response Animation; Author: Medical Sciences Animations;https://www.youtube.com/watch?v=JDdbUBXPKc4;License: Standard YouTube License, CC-BY
Immune response: summary; Author: Dr Bhavsar Biology;https://www.youtube.com/watch?v=ADANgHkX4OY;License: Standard Youtube License