
A.
To determine: The cause of infection and the possible mechanism for spread of the infection in school-age children during winter months.
Introduction: The normal skin flora is beneficial to the skin as they help in protecting the human host against various other more dangerous types of pathogenic organisms. They also compete with the pathogenic organisms for nutrients and space, which results in the interference in the growth of pathogens and so help to protect the host.
A.

Explanation of Solution
Tinea capititis, ringworm of scalp that is a fungal infection that presents with circular marks on the scalp that is often with flat centers and raised borders.Tinea capititis is caused by fungal infection that thrives on dead tissue like fingernails, hair and outer layers of skin. They spread easily among children as it is spread from touching the skin of infected person or by sharing combs, bedding and other objects used by infected person.
Housepets can also spread ringworm. It is easily spread during winter because of the use of woolen caps during long winter months, reduced frequency of washing hair, using damp clothes and caps that can provide favorable conditions for
B.
To determine: The explanation of preference of superficial mycoses for skin covered areas of the body.
Introduction: Skin infections are the diseases that take place on the epidermal layer or can penetrate deep into the dermis of the skin. It can range from a common infection caused by bacteria, fungi or
B.

Explanation of Solution
Superficial mycoses, the fungal disease is restricted to the outer layers of the skin like nails, hair, and rarely invades the deeper layers of the skin or viscera and so does not induces any cellular response from the host. The fungus mainly invades the upper layers of the skin in order to derive nutrition and oxygen from the surrounding. The fungal pathogen cannot take oxygen from blood; therefore they are confined only to the region that has direct supply of atmospheric oxygen.
C.
To determine: The common methods used for diagnosis of superficial fungal infections.
Introduction: The pathogens are the disease-causing microbes. They can be present in soil, air or water and thus, are easily contracted by the human body. Such microorganisms have special proteins or virulence factors that infer pathogenicity to such organisms. Some examples of pathogenic microorganisms are Streptococcus, Staphylococcus, Mycobacterium and many more.
C.

Explanation of Solution
In order to diagnose infection from Tinea capititis, the scalp is examined under wooden lamp. If the fluorescent infected hairs are present, then hairs are taken from the scalp and performed microscopic examination and culture. The infections caused by microscopic species fluorescence a green color.
For diagnosis of Tinea capititis, the two methods are used that are clinical appearance and by potassium hydroxide. Potassium hydroxide wet mount of removed hair from scalp or skin removed from scraping is used for clinical identification. Spore size and appearance inside, endothrix or outside, ectothrix of the hair shaft can help to distinguish organisms and can help guide treatment.
Want to see more full solutions like this?
Chapter 46 Solutions
Essentials of Pathophysiology: Concepts of Altered States
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





