
Concept explainers
To review:
The levels of corticosterone after the release after a restraint is different in habituated and nonhabituated penguins. Corticosterone levels of both the penguins when they were captured, were similar. However, after the release, the level differed.
Introduction:
Corticosterone is a glucocorticoid, major stress hormone, present in many species of amphibians, reptiles, rodents, and birds, and it is mainly involved in energy regulation, immune reactions, and stress responses. The level of corticosterone differs in both the habituated and nonhabituated penguins on the basis of response levels. Stress hormones are released in the response to a threat. The physiological and behavioral mechanism developed in penguins is due to an evolutionary mechanism. Habituated penguins do not perceive humans as a threat, but nonhabituated perceive humans as a threat.

Want to see the full answer?
Check out a sample textbook solution
Chapter 46 Solutions
Modified Mastering Biology With Pearson Etext -- Standalone Access Card -- For Biological Science (7th Edition)
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Lifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:CengageHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning



