
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
12th Edition
ISBN: 9780135755785
Author: Gerald Audesirk, Teresa Audesirk
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 45.2, Problem 1TC
Summary Introduction
To explain: The reason underlying the given hypothesis and an experiment that could help to test the hypothesis.
Introduction: Pollen grains are male gamnetophytes of seed palnts. Pollen grains have a coating of sporopollenin that protects them during pollination. Pollen grains are found on the anther of the stamen and are transferred to the stigma and then the male gametes fertilize the ovum and lead to the formation of a zygote.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 45 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
Ch. 45.1 - Prob. 1CYLCh. 45.1 - diagram the life cycles of ferns and flowering...Ch. 45.2 - Prob. 1CSCCh. 45.2 - Prob. 1TCCh. 45.2 - Prob. 2TCCh. 45.2 - diagram the structure of a complete flower and...Ch. 45.2 - Prob. 2CYLCh. 45.2 - explain the processes of pollination and double...Ch. 45.3 - Prob. 1HYEWCh. 45.3 - explain how the parts of a flower develop into the...
Ch. 45.3 - describe the differences between monocot and dicot...Ch. 45.4 - The warmth of hot flowers attracts pollinators and...Ch. 45.4 - explain why many seeds undergo dormancy before...Ch. 45.4 - Prob. 2CYLCh. 45.5 - Prob. 1TCCh. 45.5 - Prob. 2TCCh. 45.5 - Prob. 1CYLCh. 45.6 - Prob. 1CSCCh. 45.6 - Prob. 1TCCh. 45.6 - Prob. 1CYLCh. 45.6 - describe how fruit structures aid in seed...Ch. 45.6 - Heat-producing flowers are rare, and many are...Ch. 45 - Prob. 1MCCh. 45 - Prob. 2MCCh. 45 - Prob. 3MCCh. 45 - Which of the following is True? a. Moth-pollinated...Ch. 45 - Prob. 5MCCh. 45 - Prob. 1FIBCh. 45 - In a flowering plant, the male gametophyte is the...Ch. 45 - Prob. 3FIBCh. 45 - Prob. 4FIBCh. 45 - Prob. 5FIBCh. 45 - Diagram the general plant life cycle. Which stages...Ch. 45 - Prob. 2RQCh. 45 - Prob. 3RQCh. 45 - Prob. 4RQCh. 45 - Prob. 5RQCh. 45 - Describe the characteristics you would expect to...Ch. 45 - Prob. 7RQCh. 45 - Describe three mechanisms whereby seed dormancy is...Ch. 45 - Prob. 9RQCh. 45 - Describe three types of fruits and the mechanisms...Ch. 45 - Prob. 1ACCh. 45 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Photosynthesis & Respiration | Reactions | Chemistry | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=3XIyweZg6Sw;License: Standard YouTube License, CC-BY