
How does the flow of a fluid in a closed circulatory system differ from the movement of molecules between cells and their environment with regard to distance traveled, direction traveled, and driving force?

To determine: The differences between the flows of fluid in closed circulatory system from the movement of molecules between cells and their environment with regard to distance traveled, direction traveled, and driving force.
Introduction: A circulatory system has three basic components including a circulatory fluid, a set of interconnecting vessels, and a muscular pumping system called as the heart. By transporting circulatory fluid (usually blood) throughout the body, the circulatory system links the aqueous environment of the body cells to the organs involved in gaseous exchange, nutrient absorption, and disposal of wastes.
Explanation of Solution
The differences between the flows of fluid in closed circulatory system from the movement of molecules between cells and their environment with regard to distance traveled, direction traveled, and driving force are given as follows:
Characteristics | Flow of fluid in closed circulatory system | The movement of molecules between cells and their environment |
Distance traveled | Millimeters to meters | Less or equal to 1 millimeter |
Direction traveled | Single direction | Random direction |
Driving force | ATP-driven muscular pump | Diffusion |
Want to see more full solutions like this?
Chapter 42 Solutions
Campbell Biology (10th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage

